Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig251  (registered. 2012)
Contig Information
Length 868 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XF Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456051|ref|NP_001051626.1|| Os03g0805200 [Oryza sativa (japonica cultivar-group)]
Score 363
Evalue 2.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig251
GACCACAGACCAACCCACCCAACAGTAAACATCATCCAAAAACTACAGCAGCAGCAACAGGAAATTAGCCCACCCGGACTTTGATGCCAGTCAGAAAATA
ACCAGTACAGGGGAAACACAAGTGCGGTGACAACAACCAGGCACAAAATAAGGTAAATGGGGGCAAGGGCACCATACCCACACCACGGTGACTACAAACC
CCAATATCTGTTTTCAGCTAAGTCAATAGAATACCATCCATCCATCACTTTCATTCAATTCTCACCATTACCAGGTGAACCCATCAGTCCCACGAGCTAG
AAGCGCCTCCACCATAACCTCCACCACCACCGTAACCGCCACCGCCACCGCCGCCATAGCCACCACCTCCTCCACCGCCGCCGCCCCTCGTGTCGCGACG
GAAGTCACGTCCACCAAATCGAGCACCGCCGCCGCCTCCTGACCTGCGGTTTCTGCCTCCTCCGCCGCCTCCAAACGAGGAACGGGCAGAATAGCGCTCC
AGCCACTGAGGAACCTCCTGATTGGCTTCCTGCATCAGTTCACACAATGGCCTGGCCAGTGACATGTTGCCCTCATTGAAAAATGCAGTTGCCAGACCAG
ACTTCCCAGCTCTACCAGTTCTCCCAATGCGGTGAACATAGTCATCTATGTCATTTGGCAGATCAAAATTGATGACGTGGGCGACATCTGGTATGTCAAG
CCCACGAGCAGCAACGTCAGTTGCAACCAGGATGGGAGTTGCTCCACTCTTGAAGGATCTCAGCGCATACTCCCTTTCCTGTTGTGTACGATCTCCATGA
ATACTTGTTGCAGGGAACCCATTTGTATACAGCCAGTTCTCCAGAGCATCAGCACCTCTCTTTGTCTC
page-top