Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2509  (registered. 2012)
Contig Information
Length 1898 bp
Clones alternative view 144 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 10
Wh_KMV Shoot grown with continuous light after cold treatment 17
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 21
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 7
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 10
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 10
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 14
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 12
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2565305|gb|AAB82711.1|| glycine decarboxylase P subunit [x Tritordeum sp.]
Score 979
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2509
AATATATGGCATCCCCATTGACAAAGTGACTAGATTATTCTACTGCTTGGTAAGATGATATCCACTGGGGCAGGCTGATAATTTAACTCTTCTTTGAGCA
GTTGTTGGCCTTCCAAAGTGAATGGCTGACCTTTAGGCTCAAGTTATCAACAGCATCTATGGATATATAAGAGTACACAATCTAAGAATAACTAGATTTT
CTTTCCGTGTATGGCTAGGACATCAAAAAAGACCTCCATTATTTGTCCTGTATTCAGAGAAGAGTGGAAATGCTAGCCAATATAGCTAATTTCACTTTCA
AATGGGAATGGGGAGGCAGTGCGGGTACAGAGGATACAGGAGAAGGTGGCATTTGAGGAGAATATATACAGTACATGAGGGATTTAGAAGCAAGCATGCT
TCCCTCCTACAGGAAGCATGATAACTTCTTGACACTGTTTCACACACCAGGATCGTCATCATCAGAAGATTACGCGGTGGCAGCTGCAGCTTCCTCCGCC
ACCTGGGATGCCTGCTGCAGAGTGCAGATCAGGTTGCGATCCCCGTACACGTTGTCCACACGACATGTCGTTGGCCAGAACTTGGCACCCCGAAGCCACG
CCGCCGGGAACGCAGCATACTCCCTAGAGTATGGCTTAGTCCATGCGTCACCCATCAGGAGTTGGGGTGGGTGAGGAGCGCCCTTCAGGACATTGTTGTG
CGCATCTGCTTTGCCATTTTCTACCTGTGCAATTTCCTCCCTGATAGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCCTTGCTTTCACTCTCAGTG
GGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCATGGAATCCATAGTCCATCAAGCGCTTCGCCACATCCTCGGGCTCAATACCGG
CAGTTGCCTTGAACCCTCTTAGATCAATGATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTGTTTCTCCAGACGCTTTGC
CATGTAGTTCGCGTTCAGGATAGCAATCTTTGAAGCTTCAGTGAGTCCCTGAGAGCCCATCATGGCTATGTAGGTGTACGAAATTGGAAGAATCAAAGCA
GATCCCCATGGAGCAGCAGAAATGGAACCAAGAGGGTCGGTTTTCTCAGGAAGAGGGAAGCCACCAGTGGGGATCACTGGATGAGATGGCAAAAATGGCG
CCAAGTGCTTCTTGACACCAATAGGACCCATGCCAGGACCACCTCCACCATGTGGAATGCAAAATGTCTTGTGAAGGTTAAGATGGCAAACATCTGCTCC
AATAAAACCAGGGCTTGTCAACCCAACCTGAGCGTTCATGTTAGCTCCATCCATATAGACCTGACCGCCGTTCTCATGAATAATCCTGCATATCTCATCA
ATGCCTTCTTCGTAGACTCCATGGGTTGAAGGATAGGTAACCATCAGAGCAGACAGGTTGTCCTTGTTTGCTTCAGCAGCTTTCCTCAACTCCTCAATGT
TAATGTTACCTTTGGCATCAGTTCCAACGGCAACAATCTTCATTCCACACATAGCAGCACTTGCAGGGTTTGTACCGTGCGCAGAGACAGGAATGATGCA
GACATTTCGGTGGTGGTCTCCTCTTGCCTTGTGGTAGGCCCGAATAACCATCAGTCCAGCATACTCTCCTGAAGCACCAGCATTCGGTTGCAAAGAGAAC
GAATCAAAACCAGTGATGGTGTTCAACAGATCGCCCAGGTTGTCAAACATTTCATGATAGCCTGCAGCTTGATCAATAGGGGCAAATGGGTGCATGTTGG
CGAACTTAGGATCAGTGACAGGCATCATCTCGACGGTAGCATTTAGTTTCATGGTGCAAGAACCAAGAGGGATCATACTGTGGCACAGTGAGAGATCC
page-top