Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2508  (registered. 2012)
Contig Information
Length 911 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_CSEC Callus 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 7
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_CA 2
WH_SP 3
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242064696|ref|XP_002453637.1|| hypothetical protein SORBIDRAFT_04g009660 [Sorghum bicolor]
Score 315
Evalue 5.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2508
TTTTTTTTTTAACATGTCCACATTGTAATTAAATGCTTTCCCCTGTCTTTCTGCACAATCAAGATAATACAATTGGATTTCAAAGGAAGACAAGAGCTGG
TGGAATAAACAAAAGGATGGAACCAACCACTCAACGAATGGCAGCATTTCGAGTACATTAACTTGGGGAAGAGCCTCACTTGGGGAACAGTGGGGAAAAT
GCTCTTGCACTCTAATGTAATACCAAGCATTTGTAACTAAACAACTTACAATTACACTTAAGCTGGAACTTGAAGTATTGGATCAGCAGGGAATTCCTCA
TATCCACTTATGCCGGTAATTCTTAACCTCGTATTTGGCTGTCTGTGACCAGCTTTCCTCTGGTACTTCTTCTTCTTCTTGAACTTGAAAACAATCACTT
TATCGTCCAGTCCCTGTTCTTCAACAATTGCATGAACAGCAGCATTGGTCACCACTGGCATGCCAATATAAGCTTTGTCTCTAGTTGACACCAGTAGTAC
CTTGTTCAAAATGATCTGATCATTGACATTGGCGTCTTTCAGCCTCTGTGTGTATATGTACCGACCTGGCATCACAATGTATTGTCTGGACCCAATCATG
ACAACGGCGAAGATGTCGGCGTCCTTCCCCGCGCCAGCAGCAGCCAGCTGCACCTCAACAGGCTCCGGAACCGCGGCATCCTCTACCACCTCCTCTGCCT
CGGCTTCCACCGGAGCGGGCGCCTCCTCGGCGGCGGCGAAGATGCGCCAGTTGCGGGGCGCGGACGCGGTGACCGAGAGAGAGGTGCTCGCAGGGAGGAA
GGCGGCGGTGTAGAGGAGTGGGGTTCTCGAGGGGAGGAGGCGGAGAGGGAGCGTGGCGGTGGCCATGGACGGGGCGCGGGACGATGGCGAGGGGGAACGA
CGGATCCTCGT
page-top