Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2502  (registered. 2012)
Contig Information
Length 810 bp
Clones alternative view 56 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 3
Wh_yd Spikelet at late flowering 1
Wh_SH - 4
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMP Shoot grown under continuous light 4
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 3
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31580801|gb|AAP55210.1|| vacuolar proton-inorganic pyrophosphatase [Triticum aestivum]
Score 293
Evalue 1.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2502
TTTTTTTTTTGACTCGGCATTTTTGAGATGATGCAACAATCGTCATGATATCATTGTTCAAGGGTTCAAACATTATCGTCGTCATCACGGGACGAGGAAA
ATTTGCCAGACACATACCAATAATGACCGAGGACATCTGGTCTCTCTCTTCTACTACATGGAGCTACAAGCCGGTAATGGTGAGACTAACGTAACACACC
CAAGAGGCCAAAGGGAAAGTGGGGGTAAACTGCGGCAATCCTGGAATAATGACACAAGAACCAAAAATAACAGCAGCGCACAACATACGAACGGCGGGCG
GGCGGGGCAGAGTTATTCGTGATGGTGTCCGTAGATTCTAAGTCCGCTCGACGAGTCTTCTAGATGTACTTGAACAGCACACCTCCGTACGTGGCGAAGA
AGGGCGCGAACACGAGGGACTCGACGGCCATCAGCTTGATGAGGATGTTGAGCGACGGGCCTGAGGTGTCCTTGAGGGGGTCTCCGATGGTGTCGCCGAT
CACGGCCGCCTTGTGGCAGTCTGAACCCTTGGGGCCAAGGGACCTCGCGTGCTCGCTGTTGCCGGCCTCAATGTACTTCTTTGCGTTGTCCCATGCACCG
CCGGTGTTGGAAGCAGAGATGGCGATCTGTACTCCAGAAACAAGGGCACCAGCAAGAACACCAGACAGGGTTTCCACGCCGAAGAGGGTTCCGACAATGA
GGGGGGTGAGCATGACCAAAGCACCCGGAGGAATCATCTCCCTGATGGAAGCATCAGTGGAGATCTTGACACAGGTGGCATAGTCGGGCTTGGCAGTTCC
CTCCATCAGT
page-top