Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig250  (registered. 2012)
Contig Information
Length 726 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255674814|dbj|BAH92330.1|| Os03g0701550 [Oryza sativa Japonica Group]
Score 186
Evalue 2.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig250
GTAAAACTGACAATATCAGAGAACCACTGCGATCACACGTCTAAGCACATAGTTATCGAATCAACCAAGCATTACAACAAACACCACTGCTACGTAACCC
GATTACATCACCTCAGGCACGGAGGACCCCTGAAGGGGTCAGAAGCAGCAGTCGCAGTCGAAGGGGCAGAGGGCGGTGCCGCCGGCGTCAGCCTTGCCAA
ACCCGAGCTCGTCGGCGGAGTAGATGGTGAGCCCGTCATTGGTGCGCCGCCGCGGCCGCTTCTCCTCAACCTCATCATCTTGGCCAGGCTCCCAGCCATT
ACCTCTGGTCTCCTTCTTGCTCTTCTTCTTGCTAGACCCCTCGGCCTTGCCCTTCTTGGGCTTCTTGGACCCCTCCTCCTCCTCCTCCTCCTCCTGCAGC
TTGCGCTTCTTGTCGGACTTGGTGGCCTCGAAGATCTCGTCAATCTCGTTGCTCTCCTTCTGCTTCTTCGTCTTCTTGGCAGAGACCTCCTTGCCCTCCT
TCTGCTCCTTCGGCTTCGGCTTCGGCTTCGGCTTCTTGGCTGCCGCCACCGCCGTCTCTCGCTCCTCGACGGGTTTCGGAGGTTTGGGCTTCTTGGCGTC
GATAGAGGGGTTGGGGGCGGAGAGCTTCTTCTTCTTTTGGGACTTGGTGGCCATTGGAGGATGTGGAGTGGGGGATTCGATGCCTCTGCCGCCGCAGAGG
AGATTAAAGGCCGGAGCTGATGAGGT
page-top