Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24983  (registered. 2012)
Contig Information
Length 711 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_SHC Shoot grown with cold treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig24983
CGCAACTAGAAACCCTAGCCATCTACCCACGCCGCCGCCGTTCCCCTCCGGCAACCATGGCTGGGATGGCATCACGCTGCGAAGGCAAGACAACCGGCGA
CAAAGGCTACTGTAGTGTGATTTATTCACCCTATCCACAGTCGTCGCCTCTTCCTCCTCGCCTGACCGACCTGTTCCAACACTTTGGTCTGGACAAGATC
CGCGCGATCATGAACAGTTCTGATGGTAAGACGTTCGAGCAAAAGATCGACAAGTTACGAGAGGAAATGAGTGCTTTCGAACGTGCTCGTGATGTATTCT
ACATCGTCGAGGGCGAGGATGGCGACGAGGACGACGAAGGCGACGAGGACGACGACGTGGATGTGGACGAGTCGGATAGAAAGCTCTTAGATGATGAAAA
GAAACCCGATATCACGAAACGACCACACACTCCTATTGGAGATGAGGTGGAATGCAAGAAGCCAAAGATAGCAGAAGGCTCAAGGTGCCAAGGAGAAGAA
CCTGAGGCTGGAGGGATAAAGAATTCCTCCTGGGTCTGATGACAGGGGAATGCAGTAAACACCAGAAGCATCAAAACTATGATCTGGAACAGTATCCTGA
ATAAACTATTTTCTGGATTATGAATGAATTCTGAAGCATGGGGCTATAAGTGAATTATGTAACATGGATTTGTAACTATGGTGGATGTTAAGTTAACGTT
CTATCAGTGCA
page-top