Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24981  (registered. 2012)
Contig Information
Length 1232 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32351008|gb|AAP76508.1|| cyclophilin [Triticum aestivum]
Score 462
Evalue 3.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24981
TGTCGTATCGATCAACGGTCGAAATTCCGAGTCCACCTTCTTTACCACCTCCCCATTCTCAGATGTAAGTTGCAAGTGAGGCTGTCAGTACCTACTTTAC
AACCTCATCTGCATCTCACCCCAGCCTCCGCAAGTGTTTTATGCTCTAACAGATTAGATTTTGGTCGCATGATCGGGCTCCTTGGGCGCGGAATCGGTGA
TCTGACAGCACCGGCATATTGTCGAAGTAGTGGTCCTGAGGATTACGCACGATGCTCGAGCTCCTTCTCTGCCTCGGTGCTCTCGCTATCTCGAGCGACA
TTAGCTGCTGGAGCGGGCTCGGTAAACAGATCTGCTCTCTCCCTCTCTTTCTCTCTCGTCCGCGGCGATACGATCCGAGATGGCGATGAGGGCGTGGAGG
CGGAGCGCGGCGGCGAGGGCCCCGGCGCACCTGTGCCTGTGGCTGGCGCTCGTCGCCGCCACCCTGGTGCTCGCCCAGGGCAAGAAATCCAACCTTTCTG
AGGTGACGCACAAGGTCTACTTCGACATCGAGATCGACGGCAAGCCCGCAGGTCGGGTTGTCATGGGACTTTTCGGCAAGGCTGTTCCTAAAACCGCAGA
GAACTTCAGAGCACTCTGCACAGGAGAGAAAGGTATGGGCAACAGCGGCAAACCTCTCCACTACAAGGGGAGTTCGTTCCACAGAATTATCCCCAGCTTC
ATGATCCAAGGAGGCGACTTCACTCTTGGTGATGGAAGGGGTGGTGAATCAATCTACGGCACAAAGTTCGGCGATGAGAACTTCAAGCTCAAGCACACTG
GACCAGGCTACCTTTCCATGGCCAATGCTGGGAGAGATACCAACGGATCCCAGTTCTTCATCACCACTGTAACTACGAGCTGGTTGGATGGCAAGCACGT
CGTGTTCGGCAAGGTGTTGTCTGGAATGGACGTGGTCTACAAGGTCGAGGCCGAGGGCAAGCAGAACGGGACACCAAAGAGCAAAGTTGTCATTGCTGAC
AGCGGGGAAGTGCCGCTGTGATGACCTGAAACGGTCTCTGGTGGAAAGCTACGGTGACTAGTTTCCGTTGTAGAAGCGTTATTATCCGGACTGTTTTCGT
GTACTTCCGTGTGAATTTAGACGGCAAGTTTTTTCCTCTTTACTATAAAAAAGTACAATGACTTGCTTACCCGTGATCTGGCTGGCAACTTTGAAGGTAT
CATACACCACCGTTCTGTTGTCAAAAAAAAAA
page-top