Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24968  (registered. 2012)
Contig Information
Length 1434 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_VABA Shoot with ABA treatment 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456005|ref|NP_001051603.1|| Os03g0802700 [Oryza sativa (japonica cultivar-group)]
Score 739
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24968
ATTAAACCCTAGAAGTCGAGCCTCCCCTTACCATCGCCGCCGCAGCCACCATGGGCTCCGCCAAGTCCTCCAAATCCTCCAAGAAGCGGAAACCTGTCGC
CCCGCCGCCAGAGTCGGACTCCGAGCCGGAGGAGACGGTCCACGAGACCGCCGCTGCCGAGGAATTCAACCAAGAGGAGCAGCCGCAGCCGCAGCAGCAG
TCGGACGCAGGAGACGAGCACCATGAGCATGACAAGGAGGTGCAGGAGACGGGAAAGGAGAAAAAGAAGAAGAAGGACAAGGAGGGCTCGGGAATCCTCA
CCAGCATGCTCTTCTCGGAGCTCCCCATCTCCGAGCTCACCGCCAAGGCCATCAGGGAGATGAACTACACCCACCTCGCCCAGATTCAAGCTCGGTCGAT
ACCACATCTGTTGGAAGGAAGAGATGTGATGGGAGCTGCCAAGACTGGCTCAGGGAAGACCCTTGCGTTCCTCATACCGGCGATTGAGCTCCTCTATAAC
CTGCATTTCTCGTCGAGGAATGGCACAGGAGTTATTGTGGTTTGCCCTACAAGGGAGCTTGCCATACAGACACACAATGTTGCCAAGGAATTGATGAAGT
ATCACTCACAAACCCTCGGATATGTAATTGGTGGTAATGGCCGGAGAACTGAAGCTGACCAGCTTGCAAAGGGGGTCAATTTGTTAGTAGCTACACCAGG
CAGGCTGTTGGACCATCTGCAAAACACCAAGGGTTTCATATATAAGAGACTAAAGTGTCTTATAATTGATGAAGCTGATCGCATTCTTGAGCAGAACTTT
GAGGAAGATATGAAACAAATATTTAAACGCCTTCCCCAGAATCGGCAGACAGTTCTTTTTTCTGCGACACAAACTAAAGAGGTTGAAGATTTTGCCAAGT
TGTCATTTGAGAAAAACGAAGAAAGGAAAGAAAAACCTGTTTATATCTCAGTTGATGATGGTAAATCAAATGCTACCGTGGAAGGCTTACAGCAGGGCTA
TTGTGTCATTCCTAGCGACAAGAGGTTTTTGGTTCTGTATGCTTTCCTAAAAAAGAAACAGTCTAAGAAGGTCATGGTGTTCTTTTCATCATGTAGCTCA
GTAAAGTTCCATGCCGAGCTTCTAAATTTTCTCCAGATAGGGTGCGAAGATATCCATGGGAGACAAAAACAGCAGAAACGAACTACAACATTCTTTAACT
TCTGCAAGGCAGAAAAGGGCATCTTATTATGCACTAATGTGGCAGCACGTGGACTTGATATTCCTGATGTGGATTATATTGTGCAATATGACCCTCCAGA
TGAACCAAAGGATTACATTCACAGAGTTGGTCGTACTGCACGTGGTGAAAANNNCAAAGGAAGCGCCTTATTGTTCTTGTTGCCGCAAGNACTGAAGTTT
CTTATTTACCTGAAGGCAGCCAAGATTTCTCTCA
page-top