Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24891  (registered. 2012)
Contig Information
Length 1948 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 1
Wh_r Root 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|284022081|sp|B9F3B6.1|SSDH_ORYSJ|SSDH_ORYSJ RecName: Full=Succinate-semialdehyde dehydrogenase, mitochondrial;"
Score 938
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24891
CGGCGGCGCTCGGCGCCCGCCACATCCTGGCCGCCTCCGCCTCCGCCTCCTCCCGCGCCGCCAGCCGCCGCCACATGGGCAGCCTGGACGCGGGCGCGGC
GATGGAGAAGATCCGGGCGGCGGGGCTCCTCAGGACGCGCGGCCTCATCGGCGGCCAGTGGGTCGACGCCTACGACGGGAAGACCATCGAGGTGCAAAAT
CCAGCAACTGGCGAGGTCCTAGCAAATGTAGCCTGCATGGGCAACAGAGAAACAGCTGATGCAATAACTTCTGCTAACACGACATTTTACACTTGGAGCA
AACTCACTGCAAGTGAAAGGAGCAAGGCACTAAGAAAATGGCATGACCTACTTATGTCACACAAGGAAGAACTTGCACTTCTTATGACACTGGAACAGGG
GAAGCCTATGAAAGAAGCCCTTGGGGAGGTGAACTATGGTGCAAGTTTCATAGAATTTTTTGCTGAGGAAGCAAAGCGTGTGTATGGTGATATTATTCCC
CCTACTCTAGCTGACCGCAGACTATTGGTTCTGAAGCAGCCTATTGGGGTAGTTGGAGCTATTACACCATGGAATTTTCCTTTAGCAATGATAACCAGAA
AGGTTGGACCAGCATTGGCTTGTGGATGCACTGTTGTTGTCAAGCCATCAGAGTTCACACCTCTGACAGCATTAGCTGCAGCAGACCTTGCTCTTCAAGC
TGGAATACCAGCTGGTGCACTAAATGTTGTGATGGGTAATGCTCCTGAGATAGGTGATGAACTAATGCAGAGCACACAGGTCAGAAAGATTACGTTCACG
GGTTCAACAGCTGTTGGCAAAAAACTGATGGCTGGATCAGCAAACACTGTGAAAAAGGTTTCTTTGGAGCTCGGTGGGAATGCGCCTTGCATTGTTTTCG
ATGATGCAGATATTGATGTTGCCGTTAAAGGCAGTCTTGCTGCCAAGTTTCGGAACAGCGGACAGACGTGTGTATGTGCAAACAGGATATTGGTGCAAGA
AGGTATCTACGAAAAATTCGCAAGTGCATTTGTCAAGGCTGTTCAGAGTTTGCAAGTCGGTAATGGGCTAGAAGAGAGTACATCACAGGGTCCTCTAATC
AATGAAGCTGCTGTTGAAAAGGTAGAGAAGTTTGTAGGTGATGCTACTTCAAAGGGAGCCAACATCATGCTTGGTGGTAAAAGGCACAGCCTTGGGATGA
GCTTTTATGAGCCAACTGTGGTAGGGAATGTAAGCAATGATATGCTTCTTTTCAGGGAAGAAGTTTTTGGTCCAGTTGCACCACTTATACCATTCAAAAC
CGAGGAGGAAGCAATCCATTTAGCAAACGACACCAATGCAGGCTTAGCCGCATACATGTTTACAAAGAGCATTGCGCGGTCATGGCGTGTTTCTGAAGCT
CTTGAATACGGGCTTGTCGGTGTGAACGAGGGATTGATTTCAACAGAGGTAGCGCCATTCGGTGGGGTTAAGCAGTCTGGGCTTGGGCGAGAAGGATCAA
AATACGGCATGGACGACTACCTGGAGATTAAGTATGTATGCATGGGCAACCTGGGTTGATGCTTGAGTTTGGCCTTCGCTTCCACCTGAATGGAGAAGAA
GGATCGAGAACCTACTGGGGCCAGGTGCGCTGATAAGCGTGGATAGCTCAGCAGGCGTAAGGTGTAAGATGGAACGAAGAGGGAGGACAGTTTTAGAAGC
TTGGAATAAAGAGAGTAAGCCGTGTCCCCGAATAAAAGCTGCAAGTCCGAGTGAAGAGTGAGGGCAGTTTAGAAGCTTGGAATAAAGAGAGTAGGCCGTG
TCCGAATAAATGGGTTGTAATGAGTTGTAAATGAATGAAACGTGAAGCACGGCTTCGTCTCTGAACTTTGGTACAGTACTAATAATCACCACGTTGTTCA
CTTGGTGCAGAGAGCAGATCCTCTAAACCGGTATAGCAAAAAAAAAAT
page-top