Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24882  (registered. 2012)
Contig Information
Length 648 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242050834|ref|XP_002463161.1|| hypothetical protein SORBIDRAFT_02g038840 [Sorghum bicolor]
Score 273
Evalue 1.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24882
TTTTTTTTTTGCAGTGATTGTGCCGAGAACAGCATCTCTTTATTCTAAATCAAACGTGCGCCAGCAGCCAAGCATACAGTACAATCGAATCACGCATGCA
GATTGTCCCGATCACGGAGCCGCGAGCCCCGTGCCGCGAAACTTGTCACGGACGACCTCATCCAGCCGCGTCGCCATCTCCGGCGTCATGTGGTTCACCC
AGTCGCCGGCGACCCCTTTCCTGAAGAAAGAGTCCCGGGGCATGGCGTGGTACGCCCCCGCCGAGCCCTTCTTGTTCACCTCCAGCCCCTTCATCTTCTC
GAAGCTGCACAGCTCCACCACCGCCTCCACGGCGCCCTCGTCGGCGGGCGAGAACGGCCGCCCCATGAACTCCGCCAGCCGCCTGACGTGCTTCCCCGTG
TCCAGCAGCAGGTCCTCGTACCTGAGGAAGAGCACCCTGTCGGGCCGCGCGAGGCTCGCGCGCCAGTAGCTGAGCACGTGGTCCCAGATCGGGCCGACGG
CCACGGCGCCGTCGCACACGTGCTCGAACAGCTCCGCGAACGGGAGCTCCGGCTGCCGGCGCCGGAGGAAGTGCCACAGCGACACCACCATGTCCTTGGG
GTCCCTGCAGACGTACGCCACCTTGCACCCGGCGATGACCGACTCGGG
page-top