Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24859  (registered. 2012)
Contig Information
Length 1418 bp
Clones alternative view 108 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 43
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 15
WH_XT Roots, 18 day old plants were grown hydroponically 28
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 22
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig24859
TTTTTTTTTTCAAATTTCAAGAATTTGTATTCAATTTTAATTATACTATTTAACAGGTTAAGGTCTCGTTCGTTTTCGGAATTAACCAGACAAATCAATC
CACCAACTAAAAACGGCCATGCACCACCACCCACTTAATCAAGAAAGAGCTATCAATCTGTCAATCCTCAAAGTGTCCGGACCCGGTAAGTTTCCCCGTG
TTGAGTCAAATTAAGCCGCAGGTTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCACTCTTGCGACCATACTCCCCCCGGAGTCTGAATA
CTTATGATTTCTCATATTGTGCTAGGAAAATCATCCATGTAATATTTCCTAATCCAAAGTCGACATTGTTTATGGTTAAGACTACGACGGTATCTAATCA
TCTTCGATCCCCTAACTTTCGTTCTTGATCAATGAAAACATCCTTGTCAAATGCTTTCGCAGTAGTTTGTCTTTGATCAATCATAGGATTTCACCCCTAG
CGATCAAATACAAGTGACCCCAACTATCCCTTTTAATCATTACTATTAACCTTCAAAACCAACAAAATCAAGGTTAATGTCCTATTCTATTATCCCATGC
TGTAATATTCAATTGTACATGTCATGTCTGCTTTAAACACTCTAATTTTTTCAAAGTAAACTATCTATTTCTACAAGAAAAGGTTTAACCCCAATCTTTA
AAAAAAAATAAAAAGAAAGGAAAAAATATATAGGAATGACTTTGCTTTAAAACAAAGATCCCTTTATATAAATCCCTCAAGTCCAACTACGAGCTTTTTA
ACCGCAACAACTTTAATATACACTCTTGGAGCTGGAGTTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATTGTTAGTCGTTAATGTTTTTAAATTGT
TCTCATTCCAATCATTGTTCCCGTTGGGACCAATACTAGTATTTCTCGTCACTACCTCCCCGAATTGGGATTGGGTAATTTACGCGCCTGCTGCCTTCCT
TGGAAGTAATGGCCGTCTCTCAGGCCTTTTCTCCGGAATCAAACCCAAATTCTCCGTTACCCATCAAAACCATGGTAATCCACTAAATTACCATCGAAAG
TTAATAGGTCAGAAACTCGTTCCTATCATCTATAAATAATTAAATTTATGATTCGTAAGTTTACTATGATTCTTCAATTTTTTTTTACAAATCCCCTAAA
AAATACCGAAAGTATAATCTAGAGTTTGGAATGATTTGTATTGATTTTGCATATTAATAAATACATTCGTTCCCTTGCGAGTTCGAACTTTTTGCATGTA
TTAGCTCTAGAATTACTACGGTTATCCAAGTAATTTATACAATAGAGTAGATTGTAACTGATTTAATGAGCCATCCGCAGGTTTACGGTTAAAAAATATT
TATCCTTAGACGTGCATG
page-top