Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24803  (registered. 2012)
Contig Information
Length 1140 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194352758|emb|CAQ00107.1|| papain-like cysteine proteinase [Hordeum vulgare subsp. vulgare]
Score 491
Evalue 7.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24803
AACAAGAACAAGCTGAAAAAGCATGTGGTAACAATCGATGGCTACAAGGAGGTGCCTCCTAGCAAGGAAGACTTGTTACTACAAGCTGTTGCCCAGCAAC
CCATTAGCGTAGGAATATGTGGCAGCGCTAGAGCATTTCAGCTATACTCCCAGGGTATCTTCGATGGTCCATGCCCAACATCTCTTGATCATGCTGTCCT
AATTGTGGGATATGGTTCTGAAGGTGGCAAGGATTATTGGATTGTGAAAAATTCCTGGGGTGAAAGATGGGGAATGAAGGGCTATATGCATATGCACCGA
AACACTGGCTCATCGTCAGGTATCTGTGGCATAAACATGATGGCATCTTTCCCCACAAAAACAAGCCCGAATCCTCCTCCTTCACCTGGCCCTGGCCCAA
CCAAATGCAGCGTTTTTACCTCCTGCCCTGAAGGATCCACCTGCTGTTGCTCATGGCATGCCTTGGGATTCTGCCTTTCCTGGAGCTGTTGCGAGCTGGA
TAATGCAGTTTGCTGCAGTGATAACCGTTCTTGTTGCCCCCATGACTATCCTATATGTGATACAGCTAGGGGACGTTGCTTGAAGGGCAATGGCAACTTC
TCCAGCATAGAGGGAATCAAGAGGAAGCAAGCTTTCTCCAAGGTTCCCTCTTGGAATGGTTTGTTGGAACTGCTGGATCAATAGACATACAAAAAATTAC
GGATCACAGACAGATACACATGTGCGCATGATCTTATACAAGCGGCGGGGGTTCGCTGCGTTCTTGAAGTGTTCTGCCGCATTGTATGCTCCCATAGTCT
CTATCTGCTGGCTGTCTTGCAGAGCTGTCCAATGTCGTTATGAGAGACAAAAAGGAGATGTCCAGAACTCCAAAATTTTAGTGTGTATTGGTGAGTCATC
GCAGCTGGTACTGTATTGTATATTTCCATGATAGTACGTGTCAGGTACTCAGGTTAGCCTATGATGGGTTCAGTCAGATATTGGTTACATGGCACAGATG
GTTTATTTGTACTCAGCTTGTACTAGATGTGAGAGAACCGCCCATAATACAATAAAGAGATAGGTGCATCAGGTTCAGTAATCTGTTTGTGGCTGTGTTT
ATGCAACCATTTTCGAACATGGCTCCAGCAACTGTACAAC
page-top