Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2479  (registered. 2012)
Contig Information
Length 838 bp
Clones alternative view 57 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 9
WH_XF Seedling, infected with leaf rust 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22204118|gb|AAM92707.1|| putative glycine decarboxylase subunit [Triticum aestivum]
Score 306
Evalue 2.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2479
TTTTTTTTTTAAGCTAAAAAAAACTTAGATAAACCATATTAGAGTAGTTATATATGATGATTTGTTGGTGGATGATAATGTCTCTTTTTACCAACACACT
ATAACTTACAAACTCTTTCCCATATCTCTGATGTCACGGTCACTGAAATGGTATAACAAAGTGCTGGCCGCCATGTACACCGACACAAGAAAATTGGAAC
CGATGAACTGAACGCATGGTGAAGCTGGTTTAATTATTGTAGACAAGAGTATTCGATATGGTTGCAGCAAAAGGATTGATAAGCGAACAAGGGAGCACTA
GTGGGCGTCCTCCTCCTCGCAGTGCTTGGTGTACTTGGCCGAGTCCAGCAGGCCCTCCAGCTCCGCCGGGCTGCTCGGCTTCACCTTGATCATCCACCCC
TCCTCGTACGGGCTCGAGTTGATCAGGCCCGGGGTCTCGGACAGCTTCGAATTGACCTCGACGACCTCGCCGGAGATGGGCGAGTTGACGTCGCTGGTGG
CCTTCACACTCTCCACGTTGCCGAAGGCCCCACCCTGGCTCACCTTCGTGCCGGTCTCCGGCAGCTCCACGAACACCACCTCCCCGAGATGGCCCTGGGC
GTGGTCACTGATGCCAATCGTGGCCACGGAGCCGTCGTTCTTGACCCACTCGTGGGAGGAAGTGTACTTCAAGCCATCAATAACGGTGGAGAAGTATCTG
GAGATCGAGTAGGCCGGGGCAGCGGCCCTGGCGCCGCTGCTTGAAATCTTGAGGGCATTGGCAGCTGAGCTTGCCCACAGCCTCAGAGCCATTGTAGCCT
AATTTAGCTGTTGCAACCTGAAGCAACAAAGTGCGGCA
page-top