Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24779  (registered. 2012)
Contig Information
Length 1028 bp
Clones alternative view 99 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 4
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 11
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_CA 1
WH_SP 6
WH_XA Root 6
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253783729|emb|CAZ76054.1|| glyceraldehyde-3-phosphate dehydrogenase [Triticum aestivum]
Score 520
Evalue 9.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24779
CGCCTCCCCCTACCCCGGACTCCGCTCGCCCTTCGACTCCGCCGCCGACGCCTCCCTCCCGCAGCAGCCACTGAACCGTGGAGCCTCGAGCGATGCTGCT
GCCTTCCTGCCCGCTACATGCTCGAGGAAATGCCTTGGATGTGCAGATCCCAAGAAACGCTAGGATTAGGCGCTCTGCGGGGTCCCTTTTAGCTCAGCAA
ACCTCCCATCTCCGTCTAGCGTCGGCGGCAGTTCCACTCCCTCGCCATGGGCAAGATTAAGATCGGAATCAACGGTTTCGGAAGGATCGGGAGGCTCGTC
GCCAGGGTCGCCCTCCAGAGCGACGATGTCGAGCTCGTCGCCGTCAACGACCCCTTCATCACCACCGAGTACATGACCTACATGTTCAAGTACGACACCG
TTCACGGCCACTGGAAGCACAGCGACATCAAGCTCAAGGACGACAAGACTCTGCTCTTTGGCGAGAAGCCAGTTACCGTCTTTGGCGTCAGGAACCCTGA
GGAGATCCCGTGGGGTGAGGCTGGTGCCGATTACGTTGTGGAGTCCACCGGTGTCTTCACTGACAAGGACAAGGCCGCTGCTCACTTGAAGGGTGGTGCC
AAGAAGGTGGTCATCTCTGCCCCAAGCAAAGATGCCCCTATGTTTGTGGTTGGTGTCAATGAGGACAAGTACACCTCAGACGTTAACATTGTCTCAAATG
CTAGCTGCACCACTAACTGCCTTGCTCCCCTAGCTAAGATCATTAATGACAACTTCGGTATTATTGAGGGTTTGATGACCACTGTTCATGCCATCACTGC
CACACAGAAGACCGTTGATGGTCCCTCGAGCAAGGACTGGAGAGGTGGCAGGGCCGCAAGCTTTAACATCATTCCCAGCAGCACTGGTGCTGCCAAGGCT
GTTGGTAAGGTTCTTCCTGAGCTGAATGGCAAGCTTACGGGTATGTCTTTCCGGGTTCCCACTGTGGATGTGTCAGTTGTTGATCTCACTGTTAGAACCG
AGAAGGCTGCATCATATGATGACATCAA
page-top