Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2472  (registered. 2012)
Contig Information
Length 778 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218186810|gb|EEC69237.1|| hypothetical protein OsI_38251 [Oryza sativa Indica Group]
Score 294
Evalue 6.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2472
CTCATCCCGATTACATACACATAAGTCAACATATGTACAGATAATGAGCAGGTTACACAAGCAATGCAACGAGAAAAGCTACTGCTAAATCCTATCTAAT
TTAATTATTTCTTCCATTCCATGGAAGAGAGAATGGAATCTCTGCCATTCCATGAACACGACAAATGGAAGTCACGGCTCAAACATAGTACAAGTTAAGT
TACCGACATGGCAGATGCTAGGATCTTGGGCACATCATCTTCTTCGCTCACTCCGCTCCGTCAAGAATGGATGCTCAAGGGCCTCTTGGGCCGTTAGGCG
GCTTGCTGGATCATAACTCAGCAGCCCTTGCAAAAGATTGATGAAGTCACCAGCAGAATGCTCAACGTTTTGCATCACCAGATTCTGAAGCCGAGGCAGC
TTCATGACAGCTTTCATGCTTTCCCGTGAGGCACATCCTTCAGACCAGTTTAAACGGCCCTTCCTCACATATTTCTCACCATGTCGATCAGCCTTCTTGA
GCATGTGATATGGCAACGGCCCAAGCACCCTCTCCATCATAGCAAGATGCTCCAAATTTTCATGGGTTTGAAACAGCGCCTCTCCCGTGCAGAGTTCAAC
TAGTATACACCCAACGCTCCAGATATCACATGGGTAACTCCATCCAAGTCCCAGGATAACTTCCGGAGCCCGATAATGCCTAGTAGAAACTACCCTCGTG
CTGGTCCTGCTGGTCATATGTGGTGCTGCCAAAATCAATAACCTTTATTGAACTGGACTTGGGCACACGTTTGTAGTA
page-top