Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24692  (registered. 2012)
Contig Information
Length 1545 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226500186|ref|NP_001152322.1|| T-complex protein 1 subunit gamma [Zea mays]
Score 714
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24692
TTTTTTTTTTGATAATAAAAGAAAACTGGCAACGTCACAAAGCTAGTTTTGCTGTTAAATTCAAGTTCTGGTATCCGTTCAGTACAAAGTCCAAAAACAA
AACCGAACAGCAACCATTCATGCAATAGTCAGATGCCAAAACGCTGATACAAATACACAACTGAAACCCGCATACCGCTCACCATCCGAACATAGGAAAA
AGCTAGTACAATCCAAACTAATACTAGACGACCCTGAAGGCCCGGCCACCATCAAACATTCCAGAAATGCAACCAGGCGACGCCATTTCACGTGTTAATA
AAACATTCTGCTCCGCGGGCGCTTTTTTCTAGCTTTGGTACACAACATCGCCGGTGCTTGCTCACTCCAACAGCACAATAGTTCTACTCCGGGATCATCT
GTTCAGTGTCGGCATCTTCACCCGTTTCAATCTGGGGTTGCTTAGGAGCACCAGAGCCAGGAGCCTGCTTCTTCTTGATTCCACTGACAATGTCGTCAAT
CCTTAGAAGCATGCAAGCTGACTCGATAGCTGTCTTGAAGGTCTGTGCCTTCACGCTGTAAGAATCCCAGATCTTCCGCTCTTTCATGTCAACAATATCA
CCAGTCCTTCCATCAACGCCTACCCAAGGATTTTCACCGTTCGCATGCTTTCCCTGGAGCTGTGTCATCGTCCTGATAACATTCAAACCACAATTTTGAA
GCAAAGTTCTTGGGATTGCTTCGAATGCTAAAGCAGCAGCTTCATAAGGCCACTTTTCTACACCTTCAACCGAAGAACTCTTTTGCTTTAGTGTTGCCGA
TACAGTCAATTCAGAAGCACCACCTCCAGGTAGAAGTTTTGGGTTTTTCAAAATGTTCCTTGCAACAGACATGGCATCCTGAAGGTTCCTCTCCACCTCA
TTCAAGATGTCCTTGCTTGCTCCCCTCAATAGAACAGTGCATGCTTTAGGATCTTTGCATTCAATAATGAAGGAAAAGAATTCATCACCGATCTTCTTAA
CCTCAAAGAGACCAGCTCGTGTCCCCACATCTGATTCTTGAAGCTCCTCTGGCCTGTTCACTATAACTGCACCACAGGCTTTAGCAATCCTGTTGTTATC
GGTCTTCCTAAGTCTACGGATTGCACTAACACCAGCCTTGCTCAAATAATGCATAGCCATGTCACTGAGTCCTTTCTCTGTGATAACCAGGTCAGGCTTG
AATTTCAAAATTTGCACACAGAGATTCTTTATGTATTCTTCCTCCATATCTAGCAGAACCTTCCAATCTTCTTCACTCATCAACTCAGCATTTGTCTGAT
TTTCTCCCTTTTTGTACTCAACAGGACAATCCAAAAGGATGATGCGTGGATTTACTATCTTCCTTCTCATTTTTCCAGGAGCCACAACATCTTTATTGAA
CATGACCCCTTTAAGAACCATTGAATCCTCCAACTGGCCGCCAGGAATCTTCTCTACTTTGATATATTTCTTGATATCAACTTCACGCATTCCNNNNCCA
AGGTCTACACCTGCTGTTGTAGTAGCATCTATGCCTCGTGCCGAA
page-top