Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2467  (registered. 2012)
Contig Information
Length 721 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 23
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|121974|sp|P02276.1|H2A2_WHEAT|H2A2_WHEAT RecName: Full=Histone H2A.2.1
Score 287
Evalue 7.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2467
ACAAACACTGCATTAGAGACCAGATTGATTCAGAAGAACAGAGGAAGCAAGACGCTTCCTCTTCGTTCACGGTTACATGGCGGGGCAAAGCAAAAGTACA
AGCTTGAGCACTCTCTGGAACACACCACAGCTAACTTAATTAACACAGACACTAGGCACACGAGGGCTGCCGGAGCACCACCGGCACGGTCGCACACTAC
TAGGATCTAGGCCTTGGTGGCCTTCTTGGGGGACTTGGTGGCCTTCTTGGGCGACTTGGCGGCGGTGCCGGCCTTCTCAGCCTTCTCGGCGGCCTTCTTG
GGGAGCAGCACCGGGTTGATGTTGGGGATCACGCCGCCGTGGGCGATGGTGACGCCGGACAGCAGCCTCCCGAGCTCCTGGTCGTTGCGGATGGCCAGCA
GCAGGTGCCTCGGCACGATGCGGGTCTTCTTGTTGTCCTTGGCGGCGTTCCCGGCCAGCTCCAGCACCTCGGCTGCGAGGTACTCGAGGACGGCGGCGAG
GTAGACGGGGGCGCCGGAGCCGACGCGCTGGGCGTAGCGGCCCTTCTTGAGGTAGCGCCCGATGCGGCCGACGGGGAACTGGAGCCCGGCCTTGATGGAC
TTGGTCACCGACTTCTTCCTCGGCCCGCCGAACTTCTTCGCCGCCACCTTCTTCGCCTTGCTGCCGTCCATCTTGCTTCCTTGCTTGGGCTCCGGCGGGA
GGGGCTGAGAGTGGGTGGAAG
page-top