Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24666  (registered. 2012)
Contig Information
Length 830 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293334607|ref|NP_001170168.1|| hypothetical protein LOC100384108 [Zea mays]
Score 249
Evalue 3.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24666
TTTTTTTTTTCACAGCCAACAATCATATATCAACAGGTCAAACCATCTCAGTTAAAAGCAGCAGCAGCAGCAGCAGCAGCAGAGCAACTTGCACCACAAC
CAGACCAAAGAATATATGAGCCTTTCCGGCGAATCAGCTAAGGTGCATCACCAACATCATCATCCCTCCTAAACCTGGATAATTAATTAAGCTACACAGA
CAGGGCCCGCTGCTCGCGGAGCGGACTAATGTCCCCCACTATGTACACCGTCGCTCCTGCGAGGCGCCCTAGCAACAAAACAGGGGCAAGGTCGGTCGGT
CGGTCGGTATTCTACACGGGGGCCGCCACATAAGGCGGCGGTTTCCACCCTCTTGTACACCGGAGAAGAGTTTGGTCCGGCATGGCTGTGCGTCAGCTGT
CGTCGTCCAGAGACCCGATGTATGTCAGCTCCGTCCTCCGCACCCTGACCGCGCCCTTGAGCCAGCTGCACGCCTTCAGGTTGGAGTGGTCGGGGGCGAT
GCCGCTGGCGCTGTTGCTTCCTGATGATGTGGAGGGGCAGCTGGTGCCGTCCTCAAGCAAGGTCCAGGGGTCTACCTCCATCTCGGGGTCTTGGGGAGGC
AACACCGCCTTGCTTCTGCCCGAGATGTTGGTGGGAACCCAACTGTGAGAAGTGCTTTTCTGTTGAGGACCTGATGTAGATGGAGTGCTCTGGAGTGGTG
ACAGTGCAGCCAGGGACAGCTGGGGAGGCTGGCATTGTATACTAGGGTGCCGAGCTGCTGGGAGAATCGGCATCGCCGCCTGGATCCTTCGCCTGATTGC
TCCAGGCAACTCCATATGGTCCAACGCAGA
page-top