Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2463  (registered. 2012)
Contig Information
Length 914 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22296816|gb|AAM94368.1|| protein phosphatase 2A regulatory A subunit [Lolium perenne]
Score 414
Evalue 7.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2463
TTTTTTTTTTGGTAAAATCACACCCAACACATGGAATGACAGAAATCAAGTTCAAACTATCAATTTAAGCACACCATCGAAACAACGTGTCTCGTTGCTC
AATTATACAATATTAATAACAACAAAAGGGGAACATAGCCCATCCATTATCAGCATGGAAGTATAGGTAAGTTACTGGGCTAGAAAGAACTCTCGGACTC
TTAAGGGTAAATTACATGTACTCCAAGCTGGACTAAGAATAGCTTCTAAAGAACGTGACGACAGTAGCTTAGTTAGCTAGACATCATGATCTGGTCACAC
GCCTGAAGGGCCTGGTTTGCATAGTATCGTACATCCACATCAGGGTCCTCGCTCAGCTCGACAAGGCATGGCTTCACAGTCTTCTCAGCGACAGATTGAT
CAAGGATTGGTACAAGCGACTGCAGAACTTTCGCAACATTGAATTTGATGTTCGGCACTCTGTCCTTCGAGGAATTAATGACAACAGGGAGCAGCTTTTG
GCATGTTATTTCTGCACCCATGACAGGGGCTAGCAATGAGATAGCTTGCAGGATGGTCATGCGATACAGATAATGTGGGTTGTTTATCTTCTCCAACACC
TGAGGAATTATATGTTGCATTGCCCACTCTGGACCAAACTCCTCCGCCAGGCGCTTCAAGTTGTTTGCGGCAGCTTCTCTGATCGAGAAAACCTTATCTT
CCAACCATTGCATGCAAAGTGCCCCCAGCTTGTCATCAAAAAACCCAACACCTAACTGACTAGCCAGCAGAGGGATGTACTCAATTATTGCAAGGCGAAC
CCTCCAGTGCCTATCCTCCGCAAGTTCTACAATAGCCGGCAATAGAGATTGCGACAGCAAGTCAATTCCAATGACCTGATTAACTTGATCAAGCTTGCTG
ATTATGTTGAGTCG
page-top