Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2458  (registered. 2012)
Contig Information
Length 572 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440899|ref|NP_001044729.1|| Os01g0835900 [Oryza sativa (japonica cultivar-group)]
Score 208
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2458
GCACGAGGCCGCTCCTCCAATCCCACATTCGCTCGCAGCTCGAACCAAGGAGAGACCGTCAGCCATGTCCGGGCGCGGCAAGGGAGGCAAGGGGCTCGGC
AAGGGCGGCGCCAAGCGCCACCGGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTCGCTCGGAGGGGCGGCGTCAAGC
GCATCTCCGGCCTCATCTACGAGGAGACCCGCGGCGTGCTGAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCATGCCCGCCG
CAAGACCGTCACCGCCATGGACGTCGTCTACGCCCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTAGGCTCGTCCTCACCTCCGTGCAAAT
TCCGATGTGCCTATCCCCCTGTGCGCCGTAGTCTCGCTGTCCAGAAAACTTAGCTGAAATGAGTTCCCCATGTTTATCTCCGCTGTTTCCTTCGTAGGAT
TAGCTGTATCGTCAAACAAAGCTGTTCGCATCTGAAGTTTGAATCCAATCTTGTGTCTACGCAAAAAAAAAA
page-top