Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24524  (registered. 2012)
Contig Information
Length 1948 bp
Clones alternative view 42 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 3
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293331927|ref|NP_001170610.1|| hypothetical protein LOC100384654 [Zea mays]
Score 813
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24524
ACGCAAGAAATAATACTCCCTCCAATCCAAAATACTAAAGTTGAACTAGAACTGCGACAACTGATTTGGATCCAGAGTACAAATTCCAAGTGAGATTCAA
CCAGATGTTAGTATAAAAGAAAATTAGTAAGAGAAACTGCTAATATAAAACTAACATAAGAATGGGGGTAATCCGGTTCACGTAACTCCTGATTGCGCAG
GTTCCGGGGAAGCGTCCGACCAATTTAGGTCTCTTCTATGCAGTCTTTCCCAACATTTCAGCAAGGCTGCTTCCTGGACCCTAAGCCGTGACCGACCTCA
TGGTCACAAGGCAACAACTTTAGAGCTGCGCCAAGGGCCCCCTTCCAAAACTCGCATAAGTAATATCCTCACAAACATGATGAACACCAACATTTCCAAC
AGGTTCCTTAACAACCATAAGTCTGAGTACTACAACAAAATACTCAGCAGATTCAATCGCTGATTAAGTACAACTGGAGCATCTCTTACATCAAAGTTTA
TGTAACCCAATAGAAATGTAAAGGTGCTGTGTCTGAAAAGCAAACCCTCCTAGCCCCCACTTGGATCTTCAAGATGGCATGTATGTTGAAGTGTCGATCT
GCTCAGGCAGCTCCTTGATGTCAACCTCAAACCTTTCTTGCACCTGATTGAGGACGTCAGAGTCAGAGGCAGAAGCAACAAATGTTATTGCAAGCCCTTT
GGTTCCAAAACGCCCAGCCCTTCCAACCCTGTGCAAGTATGTATCAGCAGAATCAGGCATGTCATAGTTTATGACAATATTGACACGCTCAATATCAATC
CCCCTGCCAACCAAATCCGTAGCCACAAGGATCCTCTTGTGCCCTTCCTTGAAATTCTTATACCGGGTCAGCCTCTCCTCCTGTGTCATTCCCGAATGTA
TGCAGATCGCAGGAAAATTGCATTCACAGAGCAGCCTGTTAAGTTCTGAAGCTCTACCAACACTTTTAACAAATATCACAATTTGGTTGAAGTCAAGCGC
ATCTAAGAGATCATTCAATTTCCGATTCTTCTCCGCCTCACTTAGTTTAATATAGTGCTGAACTAGACCATGAAGGGTCAGTTTAGCCTCGTCATCAACA
TAAATTTCCATGGGATCTTGCATAAATTTCTTGCAAACCGGGCGAATCTCCTTGCTGAGTGTTGCTGAAAACATCATCACTTGTTTATCATGGGGTGTCA
TCTTGAAGATCTCCTGGACATCTCTACGCATGTCAAGTGAATCAAGCATCTTGTCACATTCATCAAGAATGAAATGCCTCACATTCTTCAATGAAAGGTC
CTTGTCTCTAGCCAGAGCAAGGATCCTTCCAGGTGTGCCAACCACAATGTGAGGACATTCATTCTTCAACAAATCCTTGTGTTTTTTTATGTGAACGCCA
CCATAGAAGACAGCAACTTTTGTTTCTGACAGGTACTTGCTAAACCTCTCAAATTCATTGCAAATCTGGTATGCTAACTCTCGTGTATGGCATAACACAA
GTGCAGCTACTTGCCCAGCAACCGGATCAATCTGCTGGAGAGTTGAGAGGACAAAAACAGCAGTCTTGCCCATCCCAGATTTTGCTTGACAGATAACATC
CATTCCGAGAATGGCTTGAGGGATGCATTCATGTTGCACTTCGGAAGGATGCTCAAACCCACAGTCCTGGATCGCACGGAGCAGCTCTGGCTTGAGCAGG
AAGTCCCTGAACCCTGAGCTGTGGATTCCGACGTAACCCTTCTTGACGACGTCGACGGAAGGGTTGGCGGCTGCGCCGTCGACGGCGTTCTCCACCTCCT
CATCGTAGTCGACGAGATCCTCCTCGTACACCTCGGCGTCCTTGGCTTCTCCCATCCCCGCTCAGGATCTCAGACAAGGAGGAGAGGAAGAACCGTGGTA
TTTCGAGGAGCGAGGAGGCTCTTGGGGAGTACGACCTAGGTAGCACGT
page-top