Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2447  (registered. 2012)
Contig Information
Length 676 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_VABA Shoot with ABA treatment 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125575189|gb|EAZ16473.1|| hypothetical protein OsJ_31943 [Oryza sativa Japonica Group]
Score 338
Evalue 4.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2447
TATTGGTGATGAAGATAACAATGAAGAAGCAGGAACAATTTCTGCAGAAGAGAATAATGACGAGTCTGGTGAGGAAAGTGATATTGAAGCATTGTTATCG
ATTGGAATTGAAGTTGACAATGATAAGGATTTTGCTTCGCAGTCCTCACCTAGAACTTTTGAACGCATGCCAGCTAAATTAGACAAGAGAGACCGCTTTT
CATTTACCTTCTATACTGAACAATCCAGTAACAAGCCAGCTGCAGAAAAGGCTCAACACATTCCAAGGAAACGAGTTGGCTTCCGTACCACTGAGCAGGA
TGGTGATCTCAAGTTTGATCGTGTAAAGTTGTCTGGGGGCAATAGGAAACTACCGATACTACAACTTGGTATTAAGCAACTTAATAATAAAGTTCAACCA
AAACTATATGGAGTTACCCACTTCAGCCGTATTCAGATGCCCATCTCTTCAGATCCTCTTAGTGGTCTATATGAGACTGCATCTGGGTTTGACTCAGAAG
TTCTTAGTTTACAACGGAAATTCGGTCAATGGCAGGAGGATGATTCATCTGAGGAGCACTCGGATCTTAAGTTTTATGAGTATGTCGAAGCTGCAAAATT
GACTGGGGACAATCTTGTGCCAGCGGGTCAGGTTGTCTTCCGTGCAAAAGTTGGCAAACACTATCAGCTTCCTCAT
page-top