Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24392  (registered. 2012)
Contig Information
Length 512 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig24392
ACAAAGCTCTCTATCACGAATTCGATCAGGATCATCCTCCATCAGTCGAGGCTCGAGAGTGCGTGCTTCAGTTCAACAGGTCCTCACTACGAGAATGAGC
TCCTCGGACGACGCCTGCGGCAAGAAGGCGTCGTGGCCGGAGCTGGTTGGCAAGTCCATCGAGGAGGCCAAGAAGATCATCATGAAGGACAGGCCGGACG
TGAAGATCATCGAGGTCTTCCCGGTCGGCACCGCCGTGACCGAGGACTTCAGGCCCGACCGTGTCCGCATCTTCGTCGACACCGTCGCGGAGACCCCCCG
CATTGGCTAGCTTTGATTCATGCTCCACCGTTTTATGTGTGTGCGTGTGTTTGTGTGTGTTATATTCCTGAATAAACCATAGCTAGTGACTAGTGAGTAG
TGCCATGTATGCATACTACTCCTAGCTATGTCGATCGCCATGTAAGAATTAATAATTAATAAAGTTTTTTATGGGAAATAATTAAGGTTGATCAAAAAAT
TCAAAAAAAAAA
page-top