Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24383  (registered. 2012)
Contig Information
Length 1028 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116310741|emb|CAH67536.1|| H0425E08.4 [Oryza sativa (indica cultivar-group)]
Score 475
Evalue 4.00E-132
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24383
CGCCTATATATACCCCGCCCGCACGCGCCTCCTTCCCTGGCCAGACCGAGCTGCTCTTCCTCCTCCAGTTCAGACGTGGCGGTTTGACTTTCTGACCTCG
GAAACGATCGAAGGCGCCTTCCGTGGGAAAAATCCCGGGGCGATTCCTGGAGAAGAAGCCGCGGATTCAGGGGCGGTAGAGGAGAGCGCGCCTCGCCGTT
ACCAGGATTTTCGCCCCCGCCCTCGCTCCGATCGAGGAGAACTTTATTAACTACTGAAGATAACTGGTAGCGGAATGAAGGCACCATCACTGCTTGTTCA
GTGTTTCCCTGGCTTGCTTCCAAGCAAGGCCACTAGTTGTGTGCCGATTATATCAGAGAGGGATCTGCATCTACCATCACCAGCTGTTGAACTAATCCCT
TCAAAGAGTGCTCATCCTTACAAATATGCTGGAGAGAAGGTCGATGTCCAAGGTCTTGATGTTTTCAAGGGGAAGGTCAGTGTAGCAGATATGATAGCCT
TTTCCCCTTCTGAAGTAGCATCATCAAAGCATGATGGTAGTCTCAAATATTGGGAGAGTTCCATCACTATTGTGAATATTATTAAGAATGAGATCCGTGA
TGGGCAGCTGAGCTTCAGGGGCAAGCGAGTTCTAGAGCTTGGATGTGGATCTGGCCTTGCTGGGATTTTTGCCTGCTTGAAGGGTGCGTCTATAGTTCAC
TTCCAGGACACAAATGCAGAAACCATAAGATGCAGAACAATGCCCAATGTGCTTGCGAATCTTGAGCAGGCTCGGGACAGACAGAACAGACCATCAGAGA
GCCCAGTTACACCATCCAGACAGTTGTTAGCTCCCGTTGTCCATTTCTATGCCGGGGAGTGGGATGAGCTCCCCACAATTCTCTCAGTTGTGCATCCACC
TGCACAACCAACAAACCTTAGCTTCTCTGAGGATGATTTTATGGATGGCTGCAGTAGCCATGACGGAAGCAGTATAGTTGGTCAGGACCCCAGGCGATCG
AGGAAGCTTTCTGGCAGCCGTGCATGGG
page-top