Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24371  (registered. 2012)
Contig Information
Length 563 bp
Clones alternative view 67 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_SP 2
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig24371
CGGCTCGAGCAGAGGAAAGGAAGCTTTCTACCCTAGCAGAGAAAAAAAAGCAGAGGAGAGGAAGCGGAGGCGACGATGTCGGCGATGACGGCGGCGGTGC
CCTTCTGGCGCGCGGCGGGGATGACCTACATCGGCTACTCCAACGTCTGCGCGGCGCTGGTGCGGAGCTGCCTCAAGGAGCCCTTCAAGACCGAGGTCTC
CTCCCGCGAGAAGGTCCACTTCTCCCTCTCCAAGTGGGCCGACGAGAAGCAGCAGAAGCCCACTGTGCGCACAGATGATGAATGAAGATCGGGTGCCATG
GTGATTGATGTTTTGAGAAGTTGTTGAGTCAGGGCTTAAGAACTTGAGAATAAATTCTTGCGGTGACAATGGATCTATTCCGATACTATGTTGTTATATT
TACTAATTGCTCCTTTTCTACTTGATGAACCTGAACCATGTGAAACTCGTGTCTTGTGGTGCTCGAGTGAGCGTGTTTTTATGCGTTATATCTTCCGATG
CTTTAATTTGGTATATATTCCAAAGCTTATGAATAAACTGTTTTACCCATGTCAAAAAAAAAA
page-top