Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24365  (registered. 2012)
Contig Information
Length 881 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 4
Wh_V4816 Shoot grown under cold condition for 16days 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|49615735|gb|AAT67049.1|| germin-like protein 4 [Triticum monococcum]
Score 447
Evalue 6.00E-124
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24365
TTTTTTTTTTGATAAAAAAATGATATTGTCAATTATTCAGAAGGTAGAAATAAATTCACTCATTACAGATACAACAATGGGATGACATATGCTCCATTTA
TTTTATAGATTAGGATGCATATCTACAAACTCAAACATGTCCCTAATTTGCGCACTGGTCCTCCGTGTAATCAGCCAACGTTTCACTTAGTTGTGGTTGT
TCTCCCAGAACTGAGCCTGGAGCCAGTCTATTGTATTCTTTTCCACCTGAAACGCCTTGGCAAGAACATCATCGGATATTTGTGGGTCTGACCCAAACAC
CGCATTGGCAATTGTGATAGCCCCTGGGTTCTGGCTGCTGAGCGCGGCAATTGCAACGGCGGGCTTGTGGGGGTTGGGGTTGAATTGGAAGTGGATGAGC
CCCACGGGGAAGACGAACGCATCACCTTTGTTGAGCACCTTCGAGAGGAACTTGTTTCTGTTTGGGGCGGGCTTGTTGGATGTGACAAAGCCAACGTACA
GTGTCCCCTCAAGCACCGTGAGGATCTCAGTGGCGCGAGGGTGCGTATGTGGTGGGTTTTGACCCAAGGGAGCATAGTCGATGCGCGCAATTGAGATGCC
GAGGGTGTTGAGTCCAGCAATCTGCATGACGTTGATCAAAGTGACGTTGGATCCAACCTTGTTGGTCACCCTAGGCTTGTCGAGGGCGGCTGCCTTGAAG
AAGTCATCAGCGTTGACCTCCATTGGGTTCTTGCAAACAAACCCATTGACACGTACTGGTGAATTCATGTCGGCGACACAAAAGTCCTGGAGGGGGCTAG
GATCGGAGGCAGTGGCCTGCCATGAGACCAACGCAAGAAGAACAGCAAGGAGAAGGAAGGAAGAGGATGATGCCATCTGAT
page-top