Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2435  (registered. 2012)
Contig Information
Length 1168 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_KMP Shoot grown under continuous light 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470619|ref|NP_001058908.1|| Os07g0152800 [Oryza sativa (japonica cultivar-group)]
Score 512
Evalue 4.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2435
GTAGGCCTCGCACGCCAATGGCAGGTGCACCACCAAAACCGTGGGAACGTGCTGGGGCTGAGGGAACATCCGGTCCGTCGCCTTTCAAACCACCATCTGG
TGGCAGCACTAGCGATGTCGTCGAAGCTTCTGGTACAGCTAAACCTGGAGAAACCATTGCTGCTACAGAGGGGAACATGTCTGCCAATGTAAATAACCCC
ATCTCGAGGCCTATGCCCCAACGTCCTTGGCAGCAAACAGGCTATGGAAATTCCTATGGAGGAACAGGATATGGATCCAATATGTATAGTTCGGTTGGTG
GATATGGCAGTACTTATGGTAGCGGCGGACTCTATGGGAATAGCATGTACTCGAGCTATGGAGGCGGTGGCGGCCTCTATGGAGGTTCCGGGATGTATGG
GGGAGGCATGTATAACAGTGGGATGGGAAGCTCTTATGGTGGTTATGGTATGGGTGGTATGGGCGGCATGGGTGGTATGGGCGGCATGGGTGGCATGGGC
GGCATGGGTGGTATGGGTCCTTACGGCAATCCGGATCCAAATTCATTTGGCCCTCCCGCAGCACCACCGGGTTTCTGGGTGTCCTTCCTACGCGTGATGC
ATGGTACCGTCAGTTTCTTTGGGCGAGTTGCATTTCTTGTTGAACAAAACACACAAGCCTTCTATTTATTCATTACAGCTATGTTGCAGCTCTTTGATCG
GTCTGGGATGCTTTACGGTGAGCTTGCGAGATTTGTCTTGCGCCTGCTCGGAGTCCGAACAAAGTCAAAGAAAGGCCGCGTTCAGGGCGCTGAGGCCCCT
GCATTCGAGGGACCTGGCCAGCAGCTTTTTGAGGCACCAAAAGCTGCCAACAACTCATGGGACAATGTTTGGGGAAACTAAGACGACCTGCCCTTTTATG
TGCCGTTGAACTTATAGAAACATACAGTTAGCCAAGGAAAGATTATGAAAGCATGCATGTGAGCAATCAATCAGAAAGCGAAGAAGAGTGCCCAGTCGGA
GGAAATTATCTGTTGTAGTTAGCGAAAGAACACAAGGGCTGCTCTTTCTGATTTTCATGGCTTAATCTGCCGTGAGCCTAATGATGTCCAGTTTGCTTTG
CTGGAGGATGCAGTGTTGTTTAAGTATTTCTGTTGTTTGTATGTATGTGGGGTAAATAATACTGTATC
page-top