Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2432  (registered. 2012)
Contig Information
Length 833 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218193179|gb|EEC75606.1|| hypothetical protein OsI_12318 [Oryza sativa Indica Group]
Score 261
Evalue 7.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2432
TTTTTTTTTTGAGAGAATCTTATGACATCATGCTTTAGATTGATTTTTGCATGCCTCCCATACTATATGCACACAGCTAATGGATTTTTATTGACCGCTG
TACCCCTAGTGCAGTCCAACAATATTGATATCTCACACAAAAAAAGTGATCTCATCCACACTAATCTATCATCGCCATAGAATCCCGTTACTGGCTAGTA
ACATGACAAGATCGCCGCTGCTACCGTGCTTGCGAAGCTGGAATAGCAGAACGGAAGTACGGAATTTCAATGGTGAATTGCACGATGAACAAATGCACTT
TACACATTTTAGGGAGATCAACTTGCGAACGAACCACATTTCTGTTGATCATACACAGGATCCACTGTTTCATTCTTGGCCTGCTAATAGAGGCATCTTG
TTGCCTTCCCACTTGTTCAATCTTTTCCTCGCTTCGGCCACCTCTTTGTTCCAGTCGGTCCTCACGGTAACCCACACCAGGATCACAGTCTGCATAAAGG
TACCTCCAATCATACCGCTCCATATGCCCGCCGCACCGAGGTCGAAGTAGAAGCCGAGGAGGCAGCCAAGAGGGATGCCGACGACGTAGTAGCAGCCGAC
GTTGACGTAGGCGACGAACGCCTGCCACCCACAGCCCACGGCCACACCTGACAATACTGGCTGGATGCCGTTGAGGATGAGGGTGAGCGCCAGGAGCGGC
GTCAGCTTGGACACCGCCGCCGCCACATCGTCGCCCCCCGTGTAAATGTAACTGATGTAGTCACGGAAGAACAGGATGACTATCGAGATTATAGCCGCCA
AGATGAACGACAGAACCGTCACCACCACCACCG
page-top