Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24269  (registered. 2012)
Contig Information
Length 1507 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66825911|ref|XP_646310.1|| major vault protein [Dictyostelium discoideum AX4]
Score 623
Evalue 2.00E-176
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24269
TTTTTTGGGGTTTGAAGTTTTTACAGTTTATTTACAGCGCTTATTGGCTAAACATGTTGAGAGGGGAGCTTGGTCCAGACAAGCTAAAGCTCTTCAATCC
AAGTCCACCGAGAAGTCTTTCTTGCATTTCAGGTCCAGCAGTTGCAATTGCCTTGAGTGTATCTTTTCCAATAGTATCAACAATCTTCTTAAATTTTGAT
GCTTCGATATGAGCAAGATCTCTTGCCTTGCTAACTTCCAATTCATTCAGAGCTTTTTGATGAGCAATTTCTGCTTCTTGTTCTCCTTTAACTTCAGCAA
GTTCAGATTCTGCTTTAATCTTGGATGCTTGTGCAGCAAGTTTGGATTGTTCAACAGCAGCGTTACCCTTAATTTCAGCTCTTGCGGCTTGAGCCTTTGC
ATCAGCAGTTGCTGCACCAGTTGCTTCAACAGTTGCACTTTGTGCTTGAAGTTCCAAAAGTTGTTTTCTTGCAGCCTCAGCTTTTGCTTTATCAACAATT
TGTTGTCTTTCAAGTTCACCACGTGCTTCTTGTTCTCTCTTCTCAGCTTCATGTCTTGCAGTTGCTTCTTGGGAACGAGTAGTAATTTCAATAGCAAGTT
GGACAGACTTTTGAAGAGCATCTCTTGTTCTTGAATCAACAGGCTCAACACTTTGGATATCAATGTTGGAAATAATCAAGTTGTTAGCTTGAAAAGCAAA
TCTGTTTCTAATCTTTGGTTCAGGAGTAGAATCATCCAATCCAAAAACAGCAGTTCTAATGATTTTTGCAGAATTTCTGTGAAATTCATCAAAAGAATGA
AGTGCAACTTCTCCTCTGACTCTGGAAGCAATTGCTTTACATGCATCTCCAACAAAGTCTGGAACAGCAAAAATTCTATCATCATTCTTTCCAGGAGTTG
TCTCAAAATGCCAATTGTATGATAATTTAAGAGAAAGTCTTGCATGATCTGCAGTTTCGACAATAACAATATCGGTCATAAAGTCAGGTCCAAGTTGAAG
ACTGAGTGATTTGATGACGTGTGGACGTTTTGGTTTATCTCCAGAGAGTGAGAGGACTGTAAATTGTTCTTCTGGTCCAAGCATGACTAGATCAGGTCCA
TAGACAACTCTTGGTGCTTTTGTTTTATAATCGAAAATTTGAACAACAGTGTTGTGTGGTGCTTTGTATGTCACAACTCTTGTTTTATCACGTGCTGCGT
TTGTTTTGTTTGGTGATGCAGCAGCGAGGACTTCTTCGACAACAGAAGGGAGATCTTTTTCCCATTTCTCTTCATCAGATTTTAACATGTAGGAGCTTCC
AATGTGAGCACGAACTTTACCGGTTTTGATATCTCTGACATAAATTCCTTCATTTCTATCAAGTGGAATAGTATGTCTGGTCTCCAAGATCTCAACATTA
ACTGGAGGAACATAGTCACATGGTCCATAAATCATCCATCTGTCTCCAGGAGCTCTGAGGATTTTTCCATCTTCAAATGCTTCACGAGCACGAAGGAGAA
GAGCAAC
page-top