Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24253  (registered. 2012)
Contig Information
Length 769 bp
Clones alternative view 121 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 5
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 9
Wh_SH - 3
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 6
WH_XA Root 3
WH_XB Root 20
WH_XC Root, treated at 50 microM Al for 6h 16
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|464639|sp|P35266.1|RL171_HORVU|RL171_HORVU RecName: Full=60S ribosomal protein L17-1
Score 336
Evalue 2.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24253
TTTTTTTTTTGGAAAAACTCATACGATGAAAAATATTCCAAAACACAACAATATTGAATCCAGTACATGAGACGATCATGGGTTTCACAAAGTATGAGCT
AGCAGTATTTAGACGACACAGATAACAGGCCAAAAATTTCCACTCAGCCAAACCAGATGCTACAAACTGCTCTAACGAATAGGCGGATAGGTTATGTAGA
GCTTCCTTCTCTAGGCCTTCCTGGCGATCTGGGACTCAGCCTCCTTCTTCACCGGCTCTTCCTTCTCCGACAAGATCAGCTCAATGTGGCATGGGTTGGA
CATGTAGGGGTTGATGCGTCCATGGGCACGGTAGGTCCGGCGCCGCTGCTTCTGGGCCTGGTTCACTTGGATGTGTGAAATGTAGAGAGCATCAACATCA
AGACCTTTCACCTCAGCATTGCTCTCAGCGTTCTTTAGAAGATCCAGAACGAACTTAGCAGACTTGGCAGGCCAGCGTCCCTGACCATTGGGCTGACGGT
TCTTCACCTGGGCTGTGCGTCCAACACCACGGCAGTACCTCCGGAAGGGGATGGCTTGCTTGTGTGCCAACACATCCTCAAGGTACCTCTTGGCCTTGTT
GAGCGACATCTTCCTCAGGGCAAGCGCTGTTTCCCTAGTGTTCTTGAAATGAACACGCAGGTCCCGGCCCATGGCCTTGGCGGACTTGGTGGGATTGGCG
GGATCCGTCGAGTACTTCACCATGGCTGCGGCGGCGCGGGAGAGAAGGCAGCGGCGGCGGCCCTCGTGC
page-top