Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24243  (registered. 2012)
Contig Information
Length 1911 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|28876011|gb|AAO60020.1|| putative protein kinase [Oryza sativa Japonica Group]
Score 672
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24243
CGCACGCCGAAGCGACCCCCTCCGCCCCGACCGCGTCTCTCCAGCCCTAGGGTTTCCGCCTCCTCTCCGCCCATAGCCATCTCCACGCGGCACGCCGCAG
CCCCGCGGATTCCTCCCCCCTTTTCGAGCTCAAAATTGCGGCTTTTCCGCTCGATTCTCGGGCACGAATCGGCCATTGATTTCCTCCGGTTATCCAAGGT
TTTCCCCTGATTTTTCGCGGCGCGAGCGGGGGCTTCCCGAGGCGATTGGTGCTCTGGAGCGGTCTCTTGTCCGCCGCGGGTTCGGGCTGCGGCTGAAGGC
CTCGCCGATTTTTCCATGAGCGTGGGCCGCGCGAGCTGCCGGGGCCCCGGTCGTCGGGGCGCGCGCGCGGGGTGCTCGTGTTAATGCATCGGCTGACCTG
CGGCTGCAAGTTCGCCGACCCCGACACGGTCGTCCCCTCCGCGGCGGCGGCGTCGCATCGCGTGCGGCCGGACACCATGAGCTGCGGCAGCGACGGGTGC
AGGGACGGCGGCAGCGAGGGGTTCGGGCGGTCGCGGCCGAGCAAGGTCGCGGCCGACGACTCGGTGGAGCCCGCGCGGTGCTCCGACGCCACGTCGCCGC
CGGGGTCCTGGATTGACAGGAAGCTGCTGGTCGATCCCAAGATGCTGTTCGTCGGATCCAAGATTGGGGAGGGCGCCCACGGCAAGGTCTACAAGGGCAA
GTATGGTGATCAGATTGTAGCCATAAAAGTTCTCAACAGTGGCAGTACCCCCGAAGAAAAAGTAACACTTGAAGATCGTTTCATCCGAGAAGTCAATATG
ATGTGTAAAGTGAAACATGATAATCTTGTGAAGTTCATTGGAGCCTGCAAGGAACCATTGATGGTGATTGTAAGTGAGCTGCTACCAGGGATGTCGCTGA
AAAATTACTTGAACAGCATCCGGCCCAGCCAACTAGATATCCATACTGCATTAGGCTATGCACTCAACATAGCTCGTGCAATGGAATGTTTACATGCCAA
TGGAATAATACACAGAGACCTGAAACCTGATAATTTGTTGCTTACTGCAAACCGTAAGAAGCTGAAGCTTACTGATTTTGGACTTGCACGAGAGGAAACT
GTGACTGAAATGATGACGGCTGAAACTGGGACATACCGATGGATGGCCCCAGAGTTATACAGCACTGTCACACTTCAACGTGGTGAAAAAAAGCACTACA
CAAATAAAGTGGATGTGTACAGCTTTGGCATCGTCCTCTGGGAGTTGCTGACCAATAAAATGCCATTCGAAGGCATGTCGAATCTACAAGCTGCATATGC
TGCTGCTTTTAAACAAGTACGCCCAGCTTTCCCTGAGGACACCCCCCAGGAGCTCGCGTCCATTGTGCAGTCATGCTGGGTCGAGGACCCCGCGATGCGG
CCCAGCTTCAGCCAGATCATCCGCATGCTGGACGCTTTCCTCACGACGATCCCTCCACCACCCCCTTCGGAGCAAGACGAGGACACGACGGAGTCGGAAG
ACACAACGTCATCGCTGAGCAGCAAGAGCTCCTCGGTCTCCTCCATCGTTTCCCGCGCGACAAGCAAGCTCTCGGTCGTCCGCCATCTGTTTGCCTCGAA
GAAGGGCGGCAGCAATGGGAAGGCATGATCCGCGCCCGCCGATCATGCCCCTGAGACGTTTTTCCTTGGTGCTGTAAAGGTGTTAGCCTAGGTTAATGAT
GATACAGTGGTGGGGATGATGATACAAGAAGAGGGATCTTGTTTAGCCTAGGGTTTAGTTTGCTTGTTTTGTGTTTTGATGATACGGACGAAAAAGGATG
AAATGCAACTTGTGCAAGCTATGTGATGTATAGCTGGCGGCTGCTCTACCATAAACTTTTGTATGCTGCCATTGAGCTCAATCCAATCCCCTCTTGTTTT
CAAAAAAAAAA
page-top