Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24136  (registered. 2012)
Contig Information
Length 1450 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242033009|ref|XP_002463899.1|| hypothetical protein SORBIDRAFT_01g008500 [Sorghum bicolor]
Score 702
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24136
ACGCCGCCGTCGCCGCCTCCTCTCCAGATCCCGACCATGGAGGGCGGCAGCAGCAGCCTCGACGCGGCGATCGAGTCGCTCCTGAACACGGCGGCGGCGG
CTTAGGAGGCAGGGCGCCCCCGGAGATGTGAGAGGACTGCCCGCTGCGAGATGGCGGCGGCTGTGGCGGCGGCGGGCGGCGAGGCCGCGGCGGCGGCGCT
GGCGGCGGCGAAGAAGCGGGCGGCGTCGCGGAGCTGGATCCTGTTCGACGCGGCGGGGGAGGAGCGGGAGCTCGACGCTGACAAGTACGCCATCATGCAC
CGCGTCGACATCAACGCGCGCGACCTGCGCATCCTCGACCCGCTGCTCTCCTACCCCTCCACCATCCTCGGCCGCGAGCGCGCCATCGTGCTCAATCTCG
AGCACATAAAGGCGATCGTTACTTCTGAAGAGGTTTTGCTCAGGGATCCTTCAGATGAAAATGTTATTCCTGTTGTAGAGGAGCTCCGGAGACGACTAGC
ACCTTCAAGTTCTGCTCAGCATGATGGAAAGGATAATTTAAGTGGCCAGCATGATGCGGAAGCTGCTGAAGAAGATGAATCTCCCTTTGAGTTCCGTGCA
CTTGAGGTTACTTTGGAAGCAATCTGCAGCTTTCTTGATGCGCGCACTACTGAGCTGGAGACTAATGCTTACCCAGCTTTGGATGACCTGACATCCAAGA
TTAGTAGCCACAACTTGGACAAGGTACGGAAGTTAAAAAGTGGCATGACGAGATTGACTGCAAGGGTCCAGAAGGTGAGAGATGAGCTTGAACAATTATT
GGATGATGACGATGACATGGCTGATCTTTACTTGTCTAGAAAGTTGGCCGGGGCATCATCCCCTGTCAGTGGTTCCGGTGGACCAAATTGGTTCCCAGCA
TCCCCAACTATTGGTTCAAAAATATCAAGAGCTAGTAGAGCCAGTGCAGCAACTATACATGGAAATGAGAATGATGTGGAAGAGCTGGAGATGTTGCTGG
AGGCATATTTCATGCAGATAGATGGCACAATAAACAAATTGACAACGCTGAGAGAGTATATTGATGACACAGAAGATTATATTAACATTCAGCTTGATAA
TCACCGTAATCAGTTGATTCAGCTAGAGCTATTCTTGAGTTCTGGGACCGTCTGCTTGTCACTCTACTCATTGGTTGCTGGAGTCTTTGGTATGAACATA
CCTTACACCTGGAACGACGGCCATGGATATGTCTTCAAATGGGTGGTTATTGTATCAGGGCTGTTTTGTGCTTTCATGTTCGTCACTATTGTCGCTTATG
CTCGGCACAAGGGCCTTGTTGGGTCCTGAATAGCTGGAATAACCGCATTACTCGCTTTCTTCAACTGTAAATTTTGAGCTAGAGCATCAACTTTGCGGAT
GATTCATCTCTTGNNNNNNATTCATTAGTATGGAATTAGGGATGATGAAA
page-top