Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24078  (registered. 2012)
Contig Information
Length 1228 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108864299|gb|ABG22460.1|| 3' exoribonuclease family domain 1-containing protein, putative,"
Score 529
Evalue 2.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24078
CTCCCTTCACCACCAGGACCTCCCCTACCCCACGCACCGCCGCCGCGAGGGTGACCACGCGAAGCAGCCGTCGCTGATTAGCTACAGGGGGGCGGACCAA
CAAGACCGCCACAGCCCACAGACACCCCAGGAGGCCGGGTGGCATAAACCCTAGGAAGCCCGCGGCTCTTCCCTCTCTCTCTCTCTCTCCCGACAGAGCA
CGCCGCGACCCGCCGACCACAAGAATGAGCGCGGAGACCGACGCGACGGCGGCCGGCGGGCTCGCGGGGGAGATGGAGGTCGAGGCGTACCGCCGCCTCT
TCCCCCTCGCGTTCCTCGAGCGTCACCTCCGCGAGTCCGTCCGGCCTGACGCCCGCCGCCTCGCCGAAGCCCGCCCCACCACCGTCGCGCTCGGCGCCGT
CTCCTCCGCTCACGGCTCTGCCCTCGTCCGCCTCGGTGACACCGCCATGCTCGCGTCGATCAAGCTCGAGGTGATGTCGCCCTCTGCCGAGACCCCGGAC
CAAGGATCAGTCGCTGTGGAGTTCCACATGCCGCCTATCTGCTCCCCGCTTGTAAGGCCAGGACGGCCAGCAGAGGCTGCGCCTGTCATCTCCAAGGCCC
TGGAGGACGTCCTCATGAGCTCTGGGATGTTAAATTTGAAGGAGCTCTGTTTGATCAGTGGGAAGGCTTCGTGGGTAGCATACCTGGATGTCTATTGTTT
GAATGCTGATGGATCTTTGTTTGATGCTGCACTGATCTCAGTGGTGGCTGCATTTACACATTTGGAAATTCCCCTAGTATCTGTTGGTGATGATGGTAGA
GTGTTTACTGTTGGAGGCAATGAAGGCAAAAGCAAATATGAATTGGTAAACAGAGAAAAGAGGAAGCTTACTCTTGGTGACATTCCATTTCCTCTCACAT
GTGCACTTCACAAGGATAGTATTCTAGCGGACCCAACTGCTGAAGAAGAATCAATAATAGAGACGTCTGTGACAGTTGTTCTAGATTCTTCCGGACGCTT
AGTGTCAATACAAAAACCTGGAGGTGGAGTGACGTCCATGGCAACAATTAAGGCGTGCATTGGCTTGGCAAAAGAAAGAGGACAAAAGTTGAAGGAAATA
CTCACGGACTCCGTTGAAGCAATGGAAGTTGACCAAGCTGAATAAGTCCGTGCAAATAGTTCTAATTCACTGGTTGTACTGGTAGTGACATAGAATTTTG
TTGCTTTTAACTGTGGTATTTTTCTAGT
page-top