Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24067  (registered. 2012)
Contig Information
Length 726 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115483310|ref|NP_001065325.1|| Os10g0551600 [Oryza sativa (japonica cultivar-group)]
Score 235
Evalue 3.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24067
CGTCTCCGCCGCCGACGACGACGAGCACACCCGCAGGCGCAGATCTGAGATTGAGTGAGTGTGTGAGAGAGAAATCGGTGGAGATGGCCGGGAGGCTGAC
TGCGATGGGATCCCGCATCATGGGCGGCCACGGCGCAGCCGCACGCGCCGCGGCCTCCGCCCTCCGCAACCGCGCCGGCATGGGCCTCCCCGCCGGCAGG
CACATCGTCCCCGACAAGCCCCTGCCTGTGAACGACGAGCTGGTGTGGGACAATGGCACACCCTTCCCTGAGCCCTGCGTCGACCGCCTGGCGCCGCACA
TCGGCAAGTACGAGGCTCTGGCGTGGCTGTGTGGAGGTCTGAGCTTCTTCGCGGCTCTCGGCCTGGCTGCCGTTGTGAATGACAAGGCCTCCAAGATGCC
TTATACACCAAAAGTCTACCCGTTCGACAATTTGAGAGCGGAACTTGGTGATAGATCATAAAATATTTCCCCCCACCTTTTCAAGTGTTGCGAGGAACTG
AACTCAGCACACCTCCTTTCATCGGGATGGTGTTTGTTGTCGTTTGTCATGTCATAAACATTGGTCTTGTAGTTTGCTGAATCGAGATAATCGATCCCAG
TTTGCGCATATCTATGCATTGATCCATGTAATAAACAATATTGGGTATCGTGTTGATTTCAGATCAATTGACGATGGTACTCTTTGCAAAAAAAAAAAAA
CTAAGTTTTTCCTCTCAAAAAAAAAA
page-top