Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2400  (registered. 2012)
Contig Information
Length 891 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218193680|gb|EEC76107.1|| hypothetical protein OsI_13368 [Oryza sativa Indica Group]
Score 204
Evalue 8.00E-51
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2400
TTTTTTTTTTGTTTTTACAACATGCAGACATTGTCACTAATAGTTGGCATTCCAGCAGCAAAGCTTCAGAGCTGCCGAATGGGGGTGGTATAATGTCTCT
TCCAGCACAAGCTTCTCGCTCATCGCATGCCCCATACATACCGTGATGTGCTCTAGGCAAACACAAAGCAGGTCCCTAGGTACCAAACTTACACAAAAAG
CGGGGCACTCGCGGCGCTCATCTTGGATGGAAGTCCTACAAACTTACAGGTCATGCGAGAAGAGAGATCATTCCAGGAGAACTTCGCCTTCGCCGATCGC
CTTGTTCATGATTTTCGTCGACACGTCTTGGTCTTCTTTCTGAGTGTCGCCGCCGCCGTCTTCTTTGTTGTTCACCAGGGTGGAGGATGTGTCGGTGTTG
TTACTGACGCTGTCTCCGTCTCTGGATGCGGCCTTTTGGGCATCGGTTGAATCCAAAGCCACCGTAGTCCCATTCGGTGGAGAATTCAGCTCGGCTGATG
TCAGGTCAGCTAAGAGTTGTGTTTGGCTGTTCGACGCTGCTGTTGAATTTACTGGCTGCTCATGCTGACCTTTCAAAGAGGTTGAATTGCCTGTCCCTGA
TCCAGCATGGTTGCTTGTCATATTCACTGGAGTTGGATCAGTCTTGCTTTCCGAGACCATGCTGGGAGTGCTCATATTTGGGTTGGACGATGCATTAGTT
GAAGAAGCCTCATTGGTTCCATTCACTCCAGGACCCCGGAATGTAATTCCATTTGACAAATTGGTGGTGCCTTCAAAGATCCTATCCATGTTCTTCAGTT
GTTCGTCGGGGNNNNNNNNNGTGACTTGGGCATCGTGGTCCAATGAACTTGACACATTGTTACCTCCAGAACTCTTCTCCCTGGCCTTGCG
page-top