Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig24  (registered. 2012)
Contig Information
Length 1554 bp
Clones alternative view 154 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 3
Wh_CSEC Callus 12
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 8
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 7
Wh_VSCB Liquid cultured tissue 16
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 10
WH_XA Root 6
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 10
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125597641|gb|EAZ37421.1|| hypothetical protein OsJ_21756 [Oryza sativa Japonica Group]
Score 731
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig24
CCTCGGCACGCCGCTGAGGTTTCCGCCGCGATCTCGTCTCGATCCGCACTCTCTATCTGAGATTTGGAATCGGGCGAGGCCTGCAGCTCCTGCCGACATG
GCGCTCGTTTTGCATTCGGGCAGTGGCAACAAGAATGCCTTCAAGGCACTTATTGCTGCAGAGTACTGTGGGGTCAAGGTTGAGCTGACCAAGAATTTTG
AGATGGGTGTCTCAAACAAAACCCCTGAATTCATCAAGATGAACCCCCTTGGCAAGGTTCCTGTTCTTGAGACTCCTGATGGTGCTGTTTTTGAGAGCAA
TGCTATTGCACGCTATGTTGCCCGCTCAAAGGGTGACAGCCTGCTTTGGGGTGGTTCTCTTATTGAATATGCGCGTGTTGAGCAATGGATGGACTTTGGT
GCCACAGAGGTTGATCCCAATATCGCAAGGTGGCTGTACCCAAGGCTTGGTTATATGCCTTACAATGCCCAGTCTGAGGAATTCGGCATTGCTGGATTAA
AGAGGGCGCTTGAAGCATTGAACACACACCTGGCATCAAACACATTCCTTGTTGGGCATTCTGTCACTCTGGCTGATATTGTCATTACATGCAACCTCTA
CCATGGTTTTGCTCGGATCTTGACCAAGACTTTCACATCTGAGTTCCCTCATGTTGAGAGGTACTTCTGGACCATGGTTAACCAGCCTAACTTCAAGAAG
GTCATTGGCGATTTCAAGCAGGCAGAGGTTGTACCTCCTGTTCAGAAGAAGGCTGCTCCTGCTAAACCAAAGGAGGCCAAGAAAGAGGCTCCCAAGGCGG
CCCCAAAGCCAGCAGAGGTTGAGGCACCAGAGGAAGAGGCACCAAAGCCAAAGCCCAAAAATCCCCTTGATCTACTGCCACCAAGCAAGATGGTACTTGA
TGACTGGAAGAGGCTATACTCAAACACTAAGAGCAACTTCCATGATGTTGCTATTAAAGGTTTCTGGGAGATGTATGACCCAGAGGGCTACTCTCTGTGG
TTCTGTGACTACAAGTACCAGGAAGAGAACACCGTGTCGTATGTGACCCTGAACAAGGTCGGCGGGTTCCTGCAGCGGATGGATCTGTGCCGCAAGTATG
CTTTCGGCAAGATGCTCGTGATTGGTTCTGAGGCGCCCTTCAAGGTCAAGGGGCTGTGGCTCTTCCGTGGGCAGGACATCCCTGAGTTTGTCATGAACGA
GGTCTACGACATGGAGCTCTACGAGTGGACCAAGGTTGACCTCTCTGACGAGGCCCAGAAGAAGCGTGTCGAAGCCATGATCGAGGACCTTGAGCCGTTT
GAGGGGCAGGCCTTGCTGGACGCCAAGTGCTTCAAGTAAGCGGATCAGTGCTTTGGATCGTGATGGCGGTGACAAAAGAACCTATCTAGGACTCAAATTC
AGTGTCGAAACAGTTGTCTTTTTTGGAAGAGTTTGCTTGTTACTTAATGGCTATTTGACCTGGTGAACTTGTTAATTTTTGTGCCATGCTAAGAGTTTTT
GGGTACCTGGTCTTGCAGTCTGTTGTTCTATTAGGTTTATGCATTTGTGTCCCC
page-top