Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23977  (registered. 2012)
Contig Information
Length 1495 bp
Clones alternative view 229 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 12
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 9
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 11
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XA Root 45
WH_XB Root 29
WH_XC Root, treated at 50 microM Al for 6h 42
WH_XD Root, treated at 50 microM Al for 6h 18
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|148508784|gb|ABQ81648.1|| glyceraldehyde-3-phosphate dehydrogenase [Triticum aestivum]
Score 672
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23977
CGCCCCGCTCCTCGCCCGGCCCCACCCGTCAGCCACCCGCCCGTTCCATTCCCGGTAGCGGAGAAACAGAAGGCGATCCGCAACCCGCGGCGCCCCGCGG
GCCCGGCCACCCAATGAAGCCCCCCGTTATATAAACACCCCCCCGGCCTCGCTAATCGCATCGCAATCTCGAGTAGCCGTCCCAATCCTCGATCTGTTCT
CAGACCCTCCTCCGTCCGTCGCAGCTCCAGATTTCCTTCCCCATGGCTCCGATCAAGATCGGTATCAACGGTTTCGGCCGGATCGGCAGGCTTGTGGCCA
GGGTTGCGCTCCAGAGCCCCGATGTCGAGCTCGTCGCCGTCAACGACCCCTTCATCACCACCGACTACATGACCTACATGTTCAAGTATGACACTGTCCA
CGGACAGTGGAAGCACCATGAAGTTAAGGTGAAGGACTCCAAGACCCTTCTCTTCGGTGAGAAGGAGGTTGCTGTGTTTGGCTGCAGGAACCCTGAGGAG
ATCCCATGGGCTGCTGCTGGTGCTGAGTACGTTGTTGAGTCCACCGGTGTTTTCACCGACAAGGACAAGGCTGCAGCTCACATTAAGGGTGGTGCCAAGA
AGGTCATCATTTCTGCTCCCAGCAAGGATGCTCCCATGTTTGTCTGTGGTGTCAATGAGAAGGAATACAAGTCTGACATCGACATTGTCTCCAACGCTAG
CTGCACCACTAACTGCCTTGCTCCTCTTGCTAAGGTTATCAATGACAGGTTTGGCATTGTTGAGGGTTTGATGACCACAGTTCATGCCATGACTGCAACC
CAGAAGACTGTTGATGGTCCTTCCAGCAAGGACTGGAGAGGTGGAAGGGCTGCCAGCTTCAACATCATTCCAAGCAGCACTGGTGCCGCAAAGGCTGTTG
GCAAGGTGCTCCCAGAGCTTAACGGAAAGTTGACTGGAATGGCCTTCCGTGTTCCCACTGTTGATGTTTCTGTTGTTGATCTGACTGTTAGACTTGCGAA
GCCAGCAACCTATGATCAGATTAAGGCTGCTATCAAGGAGGAGTCTGAGGGAAACCTCAAGGGCATTTTGGGTTACGTTGATGAGGACCTTGTTTCCACT
GACTTTCAGGGTGACAACAGGTCCAGCATCTTCGATGCCAAGGCCGGGATTGCTCTGAACGACCACTTTGTCAAGCTTGTCTCCTGGTACGACAACGAGT
GGGGATACAGCACCCGCGTGGTCGACCTCATCCGTCACATGCACAGCACCAAGTAAATGAGAGGCATGAAGATACAGGGGAGAGTGGTTTGCCCCAGAGG
AGTGTTCAAAGCCTCTTCTTCTGAGAATAAATTTTTGTATGGAATTATGTCAGCTAAAAACCTTTTATTGGATGTATCCTGATGGTTGGTCACATTTTGG
TGGTATTATGTACTTGCTTGAACTAAATCATGAGTCATTTTCACTCATCTTCTTTGGTTATCCATCACATGTCATTTCGTTCTCTAAAAAAAAAA
page-top