Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2395  (registered. 2012)
Contig Information
Length 802 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_SH - 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242086440|ref|XP_002443645.1|| hypothetical protein SORBIDRAFT_08g022770 [Sorghum bicolor]
Score 348
Evalue 4.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2395
TTTTTTTTTTATAATCAATCATCAGATCTGCCGTGTTTTATTTATTCAATTATACAGCCGTAAACATCGGGTTGTCCGCGTCGTATATACGGGTATAAAT
ACACTTCTTTCATTGTTTATTTATTATTACAGGGAGATGAGACAATGACACGGCGACCGTTGCTCCCAGGAAGCAAGAGGCATCTCAGATTTCTATGCTG
GGGCGAAAGATTTCTCTTCTCTTGTCTTCACTTCACTTGTTGGCAAAGGCGACGCCCTTGTGGATGCTCTCGGCCAGCTCGCCCTTGGCCTTCTCCAGCC
CCGCCCTCTCAAACTCGTTCAGCGGGCCGAGCGGCAGGACCTCCTCGACGCCCGACCGGCCCAGCCGCACCTTGGACGCGAAGAAGGGCAGCTCCGTCAC
CTGACAGGCTATGTAAGAGCACTCCACTATCCCGGCGTCGCCGCGCAGCCCTCTCAGGCACGCGTCCGCGAATTTGGCTGCTGCGTAGGCCATGGAAAGA
GTCGCGGATCCTGCTCCTGCTTTGGCCTCAACTACTTCTGTCCCACCATTCTGTATGCGAGAAGTGAGATAACTAATTTCTTCTGAGGTAAACGAGCAGG
GAGGATTCACCTGTGAAAGGAGTGGTAATATCGTAACTCCTGCATGCCCACCAACAACAGGAACATTGACATCTCTGGGGTCAAGTCCAAGAACCTCTCC
CACAAAGGTATTGGCTCTCACTACATCAAGTGTTGTCACCCCCAATAGGCGCTTAGGATCATATGTTCCAGCTTTTTTAAATACTTCAGCAGCGATCGGA
AC
page-top