Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23932  (registered. 2012)
Contig Information
Length 997 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|82582811|gb|ABB84343.1|| heat shock protein 90 [Triticum aestivum]
Score 177
Evalue 2.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23932
CGGCGAGAATGGCATTGTTCGGCTTGACATCATACTTAGCGAGGAAGGNNNCGTCGACGACGGCGGAGATGTCGAGAAGGGGGTTGCCCATCCCCAGGAG
CACACCCTCGAGGTTGCTCGCCGCCATTTTCTTGCTCCTCTCGACGACGGCTGCGCAAGGAGGCGAGAGCGAGATCTGAGGTCTGCGTTGGCGACTGGCG
AGAAGTCCGTTGCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATGGCTC
ATTAAATCAGTTATAGTTTGTTTGATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGC
GCATTTATTAGATAAAAGGCTGACGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCAT
TCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTG
AGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCATTAG
TGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGGATGTTGATGAGGAGAAGGAAGAG
AAGGAAAAGAAGAAAAAGAAGATCAAGGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGATGAGGAAACCAGAGGAGATCAACA
AGGAAGAGTACGCAGCTTTTTACANGAGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGTTGAGGGTCAGCTTGAGTTCAA
page-top