Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2388  (registered. 2012)
Contig Information
Length 708 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 2
Wh_VABA Shoot with ABA treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig2388
TTTTTTTTTTGCCTGTGCTAAAATTTCAAATCTCTATTAATAGTCCCACCCTGCTCTTTTACATGAAATCTTACAAACTTATATACGTTCATGCGTTGCA
AGATCAACAAGCCAACAAAGAGAGGATGAGAGGTGCCTGTCGCATGTATTATGCGTCACCAATCGAAATGAACAAAAAGAGGAGAGGCGCATAATGGAAA
GAAAGGTCTCAGTTAAATTGCCATTTGAGCTAATAATCCTAAAGAAGGAGAGAGAGCCTTGGATGTCTATGGTACAGTCATGTGGGAGCTTTCACCGGAG
GCAACTTCGACACTCCCACATCCGCGCCTACCGGCAGACGAGCAACACCACCCTGCCTACCGCGCCTCCGCCACAGCCCCCGCGCGCTGGCATGGCATAT
GGTCGGCCGCCAGATCTGGCGAGCAACCGAGCCACTGCACACCGGCTCCGTTGCCTGCAGCCACAATCGGGGTGAGCTACACCACCACGGCACGGGGACT
CCGCCCTTGTCCCGGTGCACCGACGAGCACGCTGTCACCGCCCCAGCTGTTGCAGCAAACACGTCGGCGCTGCCAGCCAGGAAGTGGCTGCCTAGCCACC
GTGGGCGAGAAGAGGAGAGCAGCGCTTGGCTGGTGTTAGTGGATGGAGAAGAGAAGGACGAGCTACTTTGGGCGATGAAGTAGCATGAGGAGGAAGATGG
CCTCGTGC
page-top