Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2387  (registered. 2012)
Contig Information
Length 571 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291163405|gb|ADD80301.1|| defender against cell death 2 [Triticum aestivum]
Score 222
Evalue 2.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2387
TTTTTTTTTTAACGCTAAATCCACTGAATTCTTATAGTTCATAGAGAAACTCTCGGATTACATAGCTGTGTATGATGCCACATGAATATCTAACATGCTG
ACAGTCTTAGACATTAGGACGCTACAAAATCTCGACAGCTTGTATGACAGTTGCTCATCCGAGGAAGTTCATGATCACCAGGTGGAGCACCAGATTGCAC
AGGACGAAATCAGCAAAGGCTCTTTCCGGGGGAAGATCCTTGAATTCCTTGTTGTCCTTGTTGACTTGGATACGGAGGCAAACACCAAGCACTGCAGTTC
CAATGCATGACAGGACACCAGACAGGAAAGAGTTGAAGGGGAATGACCCAACTATTCCCATGTAAACGACCTGAACCAGGGCAGTTGCGACGGCGAAAAC
CACGTACAGGTCAATGATCTTGAGATTCGTGGGCGTGGCGGCGTAGGCCTTGTTCAGGGACTGGATCAGGAGCTTGGCGTCCCCCGCGGGCTTCGGCATC
CTTGCTTCCCCGCGAGCTTCGAGCTGTGCTGTGAAGACGACGACGCGAAGATGCAGAGGTGAGCCTCGTGC
page-top