Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23868  (registered. 2012)
Contig Information
Length 1091 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058471|ref|XP_002458381.1|| hypothetical protein SORBIDRAFT_03g032570 [Sorghum bicolor]
Score 396
Evalue 2.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23868
ACGTCATTCCTGGCGGTACTGATGCTAGCAAGATGCATGCACAATCATTCATTCACACCCAAGAAAACGACTGCCCGATCGGTTCACTTCACCAGNGTTC
TGACGTTGGTGGTTATCAGTCAGCATTTGCTCACGCCGCTGCATTCATTCCGATACACAATCTTAGGCTTCTTCGCCAGACCAAGTCGCAGTCCAACGTA
CAGGGTTACATGAAAGGCAACCAACAACGGAAAACCACAACACACTACGATTATTGCAATTGCAATCCCAGTGGCCAGTTGAGCAACCAGGGACGACGAC
GCCTGCCACACATCAGCACGATGCCTCCTCCTCTGGCTCCGGCGCAGCTTTCCCGTAGCCCAGCTCGGTCATCTCCCAGCTCGTCCGCGACGCCACCTCC
CGGTGTGAACGGGTGTATTGCTCCATTTTCGTCAGCAGTTCGTGGGCAGTTGGCGCCGACACGATTATCTGCCTGCAATCGGCCTTAATAAAACCTTCTG
CCGCGCCCTTGTCGAACAGCGCGAGTAACGGATCATAGTACCCGTCGACGTTTAGCAAGCCAACTGGTTTGTCATGGATTCCGAGCTGCGACCATGTGAT
CATCTCTAACAACTCCTCCATTGTTCCATACCCTCCCGGGAGAGCAATGAACGCATCGGCTTGTCGCGCCATCTCAGCTTTCCTCTCATGCATGTCAGAG
ACTATCTTTACTTCTCCAACACTTGCACCAGATATCTCAAGGGGCATGAGTGCTCTTGGAATCACCCCGAGGACGCGGCAGCCGCCATCCAGAACCGTCT
GGGCGATCAGGCCCATCAAGCCGATGCTGCCGCCGCCATAGACCAGATCGACCCCCCTCGTCACCAGCCCCTGGCCGAGCTCGAGCGCCGCGTCGCCGAA
CACCGCGCGATTGCCGGAGTTGCTGCCGCAGAAGACGCAGATCCTGCCGAACTTCCTCGGCGGCGCGGGCGCGGCCGCGGTGGTGTCGCCCATGGCCTGG
CTTGTTTCCTCTCGGGTCCGGGGCGGGAGGATGGGGTTAAGAGCCGTCGTGGAGGAGGAGAGGAGAGGAGAGGGAGGTGTTTGGGTTCGGC
page-top