Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23855  (registered. 2012)
Contig Information
Length 1112 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 1
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 13
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|295389384|dbj|BAJ06362.1|| alpha-tubulin [Alopecurus aequalis]
Score 630
Evalue 7.00E-179
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23855
GCAGGTTCAAACATACCACAGGTTCATACAACACAACAGGTTGTAAACCAAACACCACACAGCAAACATTCAAACAGACAGACAACAGATAAAGCCGCTT
GGGCAGATCACAGGATAGTAGTAGACGAAGGGACGCTTGACGTACATCAGGTCGCAAACTCATCTGCTCTAGTACTCATCACCCTCATCACCGTCCTCGC
CCTCGTCGAACTCAGCGCCAACTTCTTCATAGTCCTTCTCCAGGGCAGCAAGATCCTCACGGGCCTCAGAGAACTCACCCTCCTCCATGCCCTCACCCAC
GTACCAGTGGACGAAGGCACGCTTAGCGTACATCAGGTCGAACTTGTGGTCGATGCGGGAGAAGACCTCGACAACGCTGGTGGAGTTGGAGATCATGCAC
ACGGCCCTCTGGACCTTGGCGAGGTCGCCGCCTGGGACGACGCTGGGTGGCTGGTAGTTGATACCACACTTGAAACCAGTGGGGCACCAGTCCACAAACT
GGATGGTGCGCTTCGTCTTGATGGTGGCCACAGCAGCGTTGACATCCTTGGGCACAACATCACCACGGTACATGAGGCAGCAGGCCATGTACTTGCCGTG
GCGGGGGTCACACTTGGCCATCATGGAGGAAGGCTCGAAGGCGCTGTTGGTGATCTCAGCGACAGAGAGCTGCTCATGGTAAGCCTTCTCAGCTGAGATC
ACTGGGGCATAGGAGGAAAGCATGAAGTGGATCCTCGGGTAGGGCACCAGGTTGGTCTGAAACTCGTTCACATCAACATTCAGAGCACCATCAAACCTCA
GGGAAGCAGTCAGGGATGAGATGACCTGAGAAACGAGCCTATTGAGGTTGGTGTATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGAT
GGCCTCATTGTCAAGGAGGACAGCCACATCAGTGTGCTCAAGGAGAGAGTGGGTGGACAGGACACTGTTGTATGGCTCAACAACAGAGGTGGAGACCTGA
GGGGATGGGTACACTGTGAACCCAAGCTTGGACTTCTTTCCATAGTCAACAGAGAGACGCTCAAGGAGAAGAGAACCAAGGCCAGAGCCAGTTCCACCTC
CAACAGCGTGAA
page-top