Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23802  (registered. 2012)
Contig Information
Length 1648 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_r Root 5
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 1
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 5
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655435|emb|CAJ01702.1|| putative AdoMet synthase 1 [Hordeum vulgare subsp. vulgare]
Score 792
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23802
GCACGAAGGCCCGGTACCAGGTCAAGGTCGGCTTCGAGGGTGGGCAGATGCCGCTGCACATGCGCACCCCGAAGCTCCGCGGGTTCAAGAACCCGTTCCG
TGTCGAGTACCAGGTCGTGAACCTGGACAAGATCGCGGAGCTCTACCCGAACGGTGGCGATGTCACCGTGGCAGACCTGGTCGCCAAGGGCGCCGTCCGC
AAGAACGAGAAGGTCAAGGTTCTCGGTCAGGGTGACATCAGCGTGAAGCTCACGGTCACGGTCGACAAGGTCTCGGCGTCCGCCGCCGAGAAGATCGTGG
CTGCTGGCGGCACCGTCTCCCAATACATTCGACCTCTTCCTTTCGGTTCTTCGGCCTCCTGAAGAATAGCATCAGCACAACTGCACAAGAGCATCGCTAG
CACGGAAGAAATGGCGGCTGAGACGTTCCTCTTCACGTCCGAGTCCGTGAACGAGGGCCATCCCGACAAGCTGTGCGACCAGGTCTCTGACGCCGTCTTG
GACGCCTGCCTGGCCCAGGATCCCGACAGCAAGGTTGCCTGCGAGACCTGCACCAAGACCAACATGGTCATGGTCTTTGGCGAGATCACCACCAAGGCCA
CCGTCGACTACGAGAAGATCGTCCGCGACACCTGCCGCAACATCGGCTTCATCTCTGACGACGTCGGTCTCGATGCTGACCATTGCAAGGTGCTTGTCAA
CATCGAGCAGCAATCCCCTGACATTGCCCAGGGTGTTCACGGACACTTCACCAAGCGCCCCGAAGAGATCGGTGCCGGTGACCAGGGCATCATGTTCGGC
TACGCCACCGATGAGACTCCTGAGCTGATGCCCCTCACCCACATGCTCGCCACCAAGCTTGGAGCTCGCCTTACCGAGGTCCGCAAGAATGGCACCTGCG
CCTGGCTCAGGCCTGACGGAAAGACCCAGGTCACCATTGAGTACCTAAACGAGGATGGTGCCATGGTACCTGTTCGTGTGCACACCGTCCTCATCTCCAC
CCAGCACGACGAGACCGTCACCAACGACGAGATTGCTGCGGACCTCAAGGAGCATGTCATCAAGCCGGTGATCCCCGCAAAGTACCTCGATGAGAACACC
ATCTTCCACCTGAACCCGTCTGGCCGCTTCGTCATCGGCGGCCCCCACGGTGACGCCGGTCTCACCGGCCGCAAGATCATCATCGACACCTATGGTGGCT
GGGGAGCCCACGGCGGCGGTGCCTTCTCTGGCAAGGACCCAACCAAGGTCGACCGTAGTGGCGCCTACATTGCCAGGCAGGCCGCCAAGAGCATCATCGC
CAGCGGCCTCGCACGCCGCTGCATTGTGCAGATCTCATACGCCATCGGTGTGCCTGAGCCTTTGTCTGTGTTCGTCGACTCCTACGGCACCGGCAAGATC
CCCGACAGGGAGATCCTCAAGCTCGTGAAGGAGAACTTTGACTTCAGGCCCGGGATGATCAGCATCAACCTGGACTTGAAGAAAGGTGGAAACAGGTTCA
TCAAGACCGCTGCTTACGGTCACTTTGGCCGCGATGATGCCGACTTCACCTGGGANNTGGTGAAGCCCCTCAAGTTCGACAAGGCATCTGCCTAAGNACA
AGACATCACATTGGGGTTATTCTTGGTCTGCTGCCTCTCAAGTTCGAC
page-top