Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23796  (registered. 2012)
Contig Information
Length 1463 bp
Clones alternative view 68 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 1
Wh_SH - 2
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 1
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218184289|gb|EEC66716.1|| hypothetical protein OsI_33051 [Oryza sativa Indica Group]
Score 558
Evalue 6.00E-157
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23796
TTTTTTTTTTCAGAGTACAAGCGGTCTCATGATGCCACTTTGGACAAAACAAGACCAAGACATATTCTTAAAGCATCTCCTTTAGTCAGGCTAATTATTG
CAACTTAGAACAAAGATCCGCTCACGGGAAAAAACAGAAGTCTGCTTCAAATTATAAGTGGACATCTGCTGAACTTTGAACAAAACAAAGCAAGGTTGAT
AGCGCCACAAGGCATATCCGTCCCGTATTCAGGCTAATTATTGATGCTCAGATCCACTCACAGGAGAATGCAAAAGGCTGTTTTTAGATTAGAAGTGGCC
TTCATTGGAACAGAAAAATAAAAAAGATGATAGCGTAAAGTTTCATCATCATCCCTCAAGAGCAGAGGCACCCGATATGATCTCAGTGAGCTCAGTAGTG
ATAGATGCTTGACGTGTCCTGTTGTATGTCAGTGTAAGACGGTCAAGCATTTCACCGGCATTTCTGCTGGAGCTGTCCATAGCAGACATACGGGCACCAA
GCTCACTGCACGCATTCTCTAGAACAGCATTATACATAACACAAGAAAACTGGAACTCGGTAAGATTCTGCAGGATTTCTGATTTTGTTTCACCTCCTTC
AATTTCATACGAATCCAGCTGACCAACCTTCCCGCCAGATTCTGATTCTTTCTCCATAACCTCTGGGGACAGTATTGTGGCCAGTGTAGGCCTAAATGAA
ATGACAGACTGAAACTTGTTAAAAACAACTCTTATAGCATCATATTCAACATTTTTCAAGATATCATCTGCCAGCACAGCAACCTGTGTGTAATTAATAG
GGTTCTTCTGCAACTCAGATACTGTCATTTCAATATGCTTCCTGGAGTCACGGATGAGTTGAACTTTCCCCTTTTCTCCTAATATGACATACTTGCTTTC
TTTCTCTGGACCAGAAGTCATTTTCTGGAGTGCTTTGCTGACTTTAACAGATGTAGAATTGATACCACCACAGAGACCCTTGTCAGATGTAATGGCCACA
ATAACATTCTTCTTGACATTTACACTAGGAGCATCCCCAAGAAGAGCTGTGAATGGCTGCCATAGACCACGTGAATTCTCAGTTCTTGTTTGAACAGCAC
GAAGCTTTGATGCTGCAACCATCTTCATTGCTTTCGTAATCTTTTGGATGTTCTTGACACTTTTCATGCGGTTCCTCACAATTTGTGTTGAGATGGACCG
TGCACCAAGCGGAGCAATCTGCGACTGGGAGGCAGCCGGGGAGAGCGCAGCCATGGTGGCTGCCGGGGAGGGGGTGTTGAGGAGGACACGCCGCCCCTCG
CGTCTTAGGGCCGCTATCGCCATCGCCATCGCCGGTGGAGTTGTTCCTCTCTGCTTTTTGCGGATCTGGAATTTCTTGCAAATGGTAGGCGAGTTCGCTG
CGCCTCAACAAACTCGATGGGAAAGNNNNNNGGAGGAGGGGTTGCCCTCGTGCCGAATTCCTG
page-top