Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23768  (registered. 2012)
Contig Information
Length 1263 bp
Clones alternative view 46 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 3
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226897529|gb|ACO90194.1|| superoxide dismutase [Triticum aestivum]
Score 309
Evalue 5.00E-82
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23768
GTTCTGAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAG
CACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAAACTCTGGTGGAGGCTCGAAGCGATACTGACGTGCAAATCG
TTCGTCTGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGAGCCCATTACGAGTT
CTATCAGGTAAAGCCAATGATTAGAGGCATTGGGGACGCAACGTCCTCGACCTATTCTCAAACTTTAAATAGGTAGGATGGCGCGGCTGCTTCGGTGAGC
CGTGCCATGGAATCGGGTGCTCCAAGTGGGCCATTTTTGGTAAGCCATAAACCCAAGTCGGACTCGCCTTCCTCCTCCCCAACTACTCCTCTCCTCCGCG
CATCGCATCGCACCGGGGGTCACCTGAGGTAGATCACATACACAATGGTGAAGGCTGTGGCTGTGCTTACCGGCAGTGAGGGTGTCAAGGGCACCATCTT
CTTCACCCAGGAGGGAGATGGCCCGACCACCGTGACGGGAAGCGTCACTGGACTCAAGGAAGGGCTCCACGGCTTCCACGTGCACGCTCTTGGTGACACC
ACCAACGGCTGCATGTCAACTGGACCACACTTCAACCCTGCTGGTCATGTGCATGGGGCACCAGAAGATGAAATCCGCCATGCTGGTGATCTTGGAAATG
TGACAGCTGGAGCGGATGGTGTTGCTAACATCAATGTTACTGACTGCCATATCCCCCTTACTGGACCAAATTCAATTGTTGGCCGTGCTGTTGTCGTCCA
CGGTGACGCTGATGATCTTGGCAAGGGTGGACATGAGCTTAGCAAGAGCACTGGAAACGCTGGTGCGCGTGTTGCTTGCGGAATCATCGGGCTCCAGGGC
TAAGATGTCATCTCCACCGGCCAACGTCGTACAGATCTGGGAACCTTTTCAGAATGCAGATTTGCAATCTCTATTCTAAATAAGCACATGATCTTTGATC
ACTTGTTAGTGTGCACCATTCGTGTGAATTCCTATGTGCTACTCTGAACTTTATCACTGTCATTTGGCTTTCGAGTTGCGTGACTGGAACGGTTCTGTCA
TGTGCTTGTGGATCTGTTGTTCTTAAGCCGCTACCAGCTCTGGACATATTTACAGAAAACGAG
page-top