Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23751  (registered. 2012)
Contig Information
Length 824 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_h Spike at heading date 2
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig23751
TTTTTTTTTTGAACAGCAGAAGGGTCCCGAAGGACCCAGTCTTTCATTAGATAAGCATCAAAGCACATTTTACATCAGGATCCAAATGAAACAGGAAATT
GCAACTAAGCCCCTGACTTTTACATGGAGGACCCCAAACTGAAAGCAAGAAACGCGATCGGGTCCCTAGCAGCCACCGCCCGGATTGAACCTCGCCGCCG
CCGGGGACGAACCACTTGGCGTGACGAAATCGCCATGGCTGCATCAGCTGCACACCACGGCCTCTGAACCGCAGCTAAATCTGCCTTCCATAAGGCACAC
ACGCCGGGAGGAATGGATTCGGCCGCCATTCAGCCAGAAGAAGCAGCGAGCCAGCGGAGACCGGCAGCCAACCAAGGGCGTCGTCGCTCCACCATGGAAT
CAGCTGCTGATATGCTCGAACACGACCTGCAAGCTTCATGTATCTGCAACACCCCTGCTCCTCATCCACGACCCAAGTGACCTGAAAGAGCAAGCTGCTG
CAGAGGGCAATCCTCGATATCTAAGAAGACCTCGGGCTTATTAGGGGAAGAGAGCTCGTGCCAGATCCACTCCCAACTGCCTCCGTCCACCATGGACGAC
AAGCCTGGGAGGCAGCCGGAGACCACCAGACGCTGCCCGGACGCGTCGATGGAGAGATCCAAAACGGCATAAAGCCAAATGCCACGGAGGCAAGTCTCAC
AGTACTACTAAACCTAAAACTACTATGAACAGGAGGCCAACCACCTAACCCATCCTCACGCCGGACGGCAGAACCACCGGAGAGAGAGAGGGAGAGGGGC
AGAGACGTGAGGCACGAGAAGACT
page-top