Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig23696  (registered. 2012)
Contig Information
Length 1539 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_VHS Shoot with heat shock treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XF Seedling, infected with leaf rust 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242045334|ref|XP_002460538.1|| hypothetical protein SORBIDRAFT_02g030150 [Sorghum bicolor]
Score 741
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig23696
CGCCGGGCAGCCGCCGCCGCCACCACCAGGATCAGGATCGGGATGGCGGCGGAGGAGGTCAGGCAGGCGTCCGCGGCCGCCACGGCGGCCGAGGCCGCGT
CCGCGTCGGTGCCGGCCCCCGCGGGCTCCCGGTGGGCGCGGGTCTGGCCCTCCGCGCTGCGCTGGATCCCCACCTCCACGGAACGCATCATCGCCGCAGA
GAAGCGACTCCTCTCCATCCTCAAAACTGGGTATGTCCAAGAACAAGTTAACATTGGCTCTGCTCCACCTGGGTCAAAAGTAAAATGGTTTAGATCATCA
AGTGATGAGCCAAGGTTCATCAATACAGTGACATTTGATAGCAAGGAGAATGCTCCCACCCTTGTCATGGTCCATGGTTATGGTGCGTCACAGGGGTTCT
TCTTTAGAAACTTTGATGCCCTTGCAAGCCGTTTCCGGGTGATTGCCATTGACCAGCTTGGTTGGGGTGGATCAAGCAGACCTGACTTTGACTGTAGAAG
TACTGAAGAAACCGAGGCTTGGTTCATAGATTCTTTTGAGGAATGGCGCAAAGCAAAAAACCTCAGTAATTTTATATTGCTTGGTCATTCTTTCGGAGGA
TATGTTGCGGCAAAGTATGCCTTACAGCATCCTGAACATGTTCAGCACTTGATTTTGGTTGGTTCTGCTGGCTTTTCGTCAGAAACAGATCATAGTTCTG
AGTGGTTAACCAAGTTCCGTGCAACGTGGAAAGGCATGCTAGTAAACCATCTTTGGGAGTCCAATTTCACTCCTCAGAGAATTGTGAGAGGATTAGGTCC
TTGGGGCCCAGATTTAGTTCGGAGATATACCACTGCTAGGTTTGGCTCACATTCAACAGGTGAATTACTAACAGAAAACGAGTCCTCCTTGCTGACAGAT
TACATTTACCACACTTTAGCTGCCAAAGCTAGTGGAGAGCTGTGCTTAAAACATATTTTTTCCTTGGGGGCATTTGCAAGGAAACCACTTCTGCACAGTG
CATCCGACTGGAAAGTGCCAACTACTTTCATATATGGTCATGACGATTGGATGAATTACCAAGGGGCGCAGCAAGCACGCAAGGACATGAAAGTTCCTTG
CGAAATCATCAGAGTCCCACAGGGAGGACATTTTGTGTTTATAGATAACCCTGTGGGTTTCCACTCGGCGATCTTCTACGCGTGCCGGAAATTTTTATCT
GGAGATGCAGAGGAGGGTCTCTCTCTTCCTGATGGCTTGATATCTGCATGAGGCGTCATCTCGTGTGATCTCATACCGAATAGCGGTATGGGCATAAAGC
AAAGCTATACGACTATAGAAATGTTCAATGACTGCTGGCGTCGCCAATTTGTTTTTGTATGTATGAATTCTGTGAATATGTCATTCATATGTGCTTGCGT
ACCAACAACACTAGTGAGACAATTATGTTTTTGTTGCAGGTCTAGATATAATTATGTCATATGCGTAAGATCTCCCTAGTCAGTTTTTAGGTCAAGTTAC
TGTGAGTGATGCTCTATATTCTTTCAGGGTCAACTTTAT
page-top