Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2367  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226530532|ref|NP_001140562.1|| hypothetical protein LOC100272627 [Zea mays]
Score 378
Evalue 5.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2367
TCGTCGCTCGTCGTTTCCCCCAATCCGCTCGCCTCGCCTCTCCTCAACCGCCGCTCCGCCCCCCGCGCCGCCTCCTGCTCCGGCTCCGGCGAGATGTCTC
GCTTCGGGCGCTCCGGCCCGCCGCCGATCCGCGACACCTACTCCCTCCTCGTCCTCAACATCACCTTCCGTACGACGGCCGATGACCTTTTCCCGCTCTT
CGACAAGTACGGCGAGGTCGTCGACATCTACATCCCCAGGGACCGCAGGACTGGCGACTCGCGAGGGTTTGCCTTTGTGAGGTACAAGTATGAGGACGAG
GCCCAGAAGGCAGTTGATCGCCTGGACGGGAGGTTGGTGGACGGGAGGGAGATGATGGTGCAGTTTGCCAAGTACGGCCCAAATGCTGAGCGGATTCAGA
AAGGGCGAATCATGGAAACGGTCCCGAAGCCAAGGGGTCGTTCCAGAAGCCGCAGTCCAAGACGGGGGTACCGTGATGATCATCGGGGCAGAGATTCTAG
AAGGCGAAGTCGGAGTCGGAGTGGAGATAGATATGGACGTGACAGGTACAGAGAGAGGGATCATCATCGTCGTAGCAGGAGTCGTAGCACTAGCCCTGAT
GATTACAAGAGGCGTGGCAGAGACAGTCCTAGTCGTAGCAGGAGCCGCAGCTACAGCCCTGATGATGACAGGAAGGGTGGCAGAGACAGTTTGTCGCCTG
CACGCAGAAGCACTAGTCGCTCCCCTCGCAAGACACCACCTCCTCGCGAGGGGTCTCCTGCTAAGCGCAATGATGATCGATCTCCTGCTAAGCGCAATGA
TGACCGTTCTCCTGTTA
page-top