Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2366  (registered. 2012)
Contig Information
Length 748 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108862691|gb|ABA98280.2|| ubiquitin-specific protease 12, putative, expressed [Oryza sativa"
Score 210
Evalue 1.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2366
ACAAACCCATTATACAATCTACCCCATTGTTCCAATGCCGGAGCAGCAAATAAAGCAATCAGTCTCGGCTATAACCATGTATACATGCCCCTACCAAAAT
CATTTTCTTATGTACCAGCTCTGCTCTGCACAAAAGAAGCAACATCTATCCTAGTGGGGTCTATCACACTCAGGACAACGAAATCAGCATGCTTGCTTCG
TTGTCAGGGAGCAGGCAAGAGGGAAAGCCTCAAAGAATATATCCTTCTGCCAACCACAGCACCGACTGTCAACAAGTAGCAAGTAATATAGGCCTTGGCA
CACAAATAACCATATATTTGACAGCATTTCCCTTCTGTTGAGGTCACTTGGCCTCTTTAGCATACTTTCTCGGATGAGGCCTTTGTCCCGAGGCTTGCAG
CCCAGATGGAAGGTTTCTCAATTGTAAATCTTCACAGGCTTCTCATATGTGTGTCGATTCTGATTAGCTGCGTAAGACCTTTTGGGTGTTGTGTCAGTAT
GCTCCAAACCAAGGTATTGTTCCCAAGCTCCATAGACATCTCTCCTCTGAAAGCGTGCAGACACAGCATCAATATCCTGGAGGTATTCTGGACGATTCAT
GGATATGAATGCAACCTTCCACTTGGCGAATTCTTCATTGGGAACTCGGAGTTTTTTCTGCACACGGTCCATTACCTCTGCAGCAGTCTCACCTTCACGG
ATGACCAGCAAAAANNGATCTCCAAAATTCTGAATCTGCTGGTTCTGA
page-top